Allele pk5000 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Strain KR1787 Strain RW7000 Sequence PK5000_L Allele pk5000 1 0 Tc1 Clone pRP10A1 Clone pRP10G11 Clone pRP10G12 Clone pRP11B5 Clone pRP11C4 Clone pRP11C8 Clone pRP11F8 Clone pRP7C10 Clone pRP7C6 Clone pRP8A6 Clone pRP8G5 Clone pRP9C12 Clone pRP9E2 Clone pRP9G2 Clone pRPRB1 Clone pRPRD12 Clone pRPRE9 Clone pRPRG7 Clone pRPRG9 Clone pRPFF11 Clone pRPHA1 Clone pRPKH12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5000_L TATGCAATGAACCTTCATTGCACACCTACAACTGATTAGAGTAAAATATA AGAATAGACGCTATGATTGATGATC Allele pk5001 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5001_L Allele pk5001 1 0 Tc1 Clone pRP10B4 Clone pRP10C12 Clone pRP10D12 Clone pRP10E3 Clone pRP10G2 Clone pRP10G6 Clone pRP7D7 Clone pRP7F11 Clone pRP8D2 Clone pRP9A2 Clone pRP9A7 Clone pRP9A8 Clone pRP9E12 Clone pRP9F8 Clone pRP9H4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5001_L TAGATGACTAATTCAGGAAAATGCGCTCTAACGATGGGTGTTCGCTAGAT TGTAGGAAACTTCAAAAGAGTGATC Allele pk500 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Strain KR1787 Strain RW7000 Sequence PK500_R Allele pk500 0 1 Tc1 Clone pRP3C6 Clone pRP5F10 Clone pRPNE6 Clone pRPOB11 Clone pRPOD6 Clone pRPUD12 Clone pRPVD9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK500_R TATAAGACAAAATTAAATAAAGCCATCGATTCTAAAATCAAAAACTCACA AAGCCATCGAGATACTGTTTTCCATTAAAACCTCCGGCAAAAAAGCAATA TGCAATGAGAAGCATCAATGTAATAATTGCAGAAAAAACAGCGTCAATGA ATACAATCATTTTTAGATC Allele pk501 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK501_R Allele pk501 0 1 Tc1 Clone pRP3D8 Clone pRP5E1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK501_R TATGTTAACCAAGCCCAAAAAGCAACTGGTCACTTAAAAAAAAAAAAAAA AGGGCAATGGTTGGGCTGGTCAGTTTCGTGGTGTTTGCTGGAGCTGCGCA TAATTGAACAAAAGGCAAGAACAAAAAATGAACCAAACCCAAAAAACAAC AAAACGTAAA Allele pk502 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK502_R Allele pk502 0 1 Tc1 Clone pRP3E3 Clone pRP4H9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK502_R TACCGCGGCGTTCCCCAACTCAACCCGTTCCAAGTCCAAATTTTTTGGCA ATTGAAAAAAAAAAAAAACAAAAAAACGTAAAGGTTTCCGCCTCCCCTCA AACAACTTCCCCCCCCCAACCCAACC Allele pk503 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK503_R Allele pk503 0 1 Tc1 Clone pRP3F11 Clone pRP5B5 Clone pRP5C7 Clone pRP5D8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK503_R TATCTATTTTATGTCTTATAGGGTGCTGGAAGCCAATACGAATGAAAAAA GAAATGGATGGGTTAATGTTGGAGATTTGCAAGGAGCCATTCATTTCAAA ATTGTTCGCTATGAAAGGATAAAGTTCTTGGTAGTTGGTCTAGAGTCGTC AATTGAGATTTATGCGTGGGCACCGAAGCC Allele pk504 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK504_R Allele pk504 0 1 Tc1 Clone pRP3F2 Clone pRP4H1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK504_R TATCTTTACTGACGTTTCCAGGGAGGTATTATAACCCCCACTACACCCAT CATCTTTTACAACCTCTGATGCTCTTTGCCTATTCGGGAAGTGGTGTCGT AAAGCTAGTGATAGATTTACAGCTATGAGGAAGAGTGTTTACAAGCCAAG TGACA Allele pk505 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK505_R Allele pk505 0 1 Tc1 Clone pRP3G6 Clone pRP6E11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK505_R TATATCACCTCCAATTATCACCCAACCCATAACACCACATATACCCCTCA ACAACACTCGCCCCCCCCTCATC Allele pk506 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK506_R Allele pk506 0 1 Tc1 Clone pRP4A11 Clone pRP4E6 Clone pRP6C2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK506_R TATAATCATTTTTTTTTTAAATATGACGTGCATGTTGACACTCCAATCCG AGAGTTAGCCAGAACCTCGGAGTGACAAAAAAGACGACGGACGGAACAGA GGAGGGATGAGCGGTGTGAATATAACAGAACAATTAGTACGAATAAAAAC CTGTTTATTGATC Allele pk507 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK507_R Allele pk507 0 1 Tc1 Clone pRP4B11 Clone pRP4C6 Clone pRP5C8 Clone pRP5G8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK507_R TAGACTAGATATTACCCCCTATCGAGCGGATGCTTTTGTTGTTTGAAGCA TTAATAGAATGGACACAGGTGTGTAATCTTTTTCAAAACTTATAAAACTT ATTGTTTTAAAAAAAGAAAATAGTTTCCAGGCATTCAACAATTTCCGAAT GTCATTTCTTATCATGGCACTCCACGAT Allele pk508 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK508_R Allele pk508 0 1 Tc1 Clone pRP4H6 Clone pRP5A12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK508_R TACGTTAAAGGTGGTCCGGACCa Allele pk509 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK509_R Allele pk509 0 1 Tc1 Clone pRP5B2 Clone pRP5G12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK509_R TATATCTGAACTTGTCAAATTGAAAAAAAGAATATTTTTCGCGCAAAAAA GAGAAAAGA Allele pk5002 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5002_L Allele pk5002 1 0 Tc1 Clone pRP10C10 Clone pRP10C5 Clone pRP11E11 Clone pRP7F10 Clone pRP8F4 Clone pRP8H4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5002_L TATATTTTCAAAATTCTACTCCGAAAGCTCTCGTGGGTGCCCGACACTGT TTGTTTATCAAATACGTAAATACGAAAAGATC Allele pk5003 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Strain RW7000 Sequence PK5003_L Allele pk5003 1 0 Tc1 Clone pRPRA11 Clone pRPRB4 Clone pRPRE2 Clone pRPRF4 Clone pRPHF10 Clone pRPHF11 Clone pRPKG1 Clone pRPZC1 Clone pRPZF9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5003_L TATAAGGCTTAGGTCGTCTTCCGGGCAGGCACAAAGGTTGCCAATTTTTG TGTGTTTACAAAAATCACTCAGAAAATCGCATTTTTTTTACGGCTATAGA ATTGCAATGTCAGGCTGCCCCATTGCGGCTTGATC Allele pk5004 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK5004_L Allele pk5004 1 0 Tc1 Clone pRPRA2 Clone pRPRC8 Clone pRPRE6 Clone pRPRH2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5004_L TACAACAAAACCGGGCGAGTTCACACCCCCCAGTTGTTTGGAGGAATTAT TTTTTTTTATTAAAAAATTAAAAAAAAAAATTAGGATGGAAGGTAAGTCA ACCCCCCCAACAAATCCATAGGTCATTTTTTTGT Allele pk5005 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK5005_L Allele pk5005 1 0 Tc1 Clone pRPRA7 Clone pRPRD8 Clone pRPRH1 Clone pRPRH10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5005_L TATATCGAAAAACTATTTTGGAGGGCCTGCCGAGCAATATGCCTTAGAGA TC Allele pk5006 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK5006_L Allele pk5006 1 0 Tc1 Clone pRPRB10 Clone pRPRB12 Clone pRPRD1 Clone pRPRE10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5006_L TACGTGGTACGTGGACACAAACTCACACTTTTGGAAATTGTTGCAATTCA TCAAATCACTGACTGAATATTTTCAAAAGCCTAAAACTTTTTTGTTGAAT TTATTGTTATGTGATC Allele pk5007 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK5007_L Allele pk5007 1 0 Tc1 Clone pRPRB11 Clone pRPRB9 Clone pRPRF10 Clone pRPRF2 Clone pRPRF3 Clone pRPRG8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5007_L TAACTGCTCGTGGTCGACAATACAACAAAGCATCTGGACAAATATATGCA TTTGTTGATGATATTGCAGTTTCAGTGGCTATTGATC Allele pk5008 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK5008_L Allele pk5008 1 0 Tc1 Clone pRPRB2 Clone pRPRC5 Clone pRPRC6 Clone pRPRE11 Clone pRPRE5 Clone pRPRF6 Clone pRPRG1 Clone pRPRG2 Clone pRPRH7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5008_L TATAGGTATAATGTGATTAGAAATCACACCCGTCAAACAAAACCTGGGAA ATGCTTGTATCATTCGAGAGATC Allele pk5009 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK5009_L Allele pk5009 1 0 Tc1 Clone pRPRB5 Clone pRPRD3 Clone pRPRE1 Clone pRPRF12 Clone pRPRF7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5009_L TATATCTGAAAGCGTTAAATCAAAGCTAGCAAATTATGTTCAAATTTATT AAAGCTCCAACCGAGTTATTTTTTTTGTTGCAAGAATTGATC Allele pk5010 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK5010_L Allele pk5010 1 0 Tc1 Clone pRPRB7 Clone pRPRC4 Clone pRPRG10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5010_L TATATCAAAAACAATCGAAGACATTATCTGAAATTCTTTTTCTCTTTTTT ACCACAGTGTTTCACATATAGACAGTCCAAGTGAAATATAACAAATTGAA AAAGAACAGTCTGTTTTCTCGATC Allele pk5011 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK5011_L Allele pk5011 1 0 Tc1 Clone pRPRB8 Clone pRPRD10 Clone pRPRD9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5011_L TAGTTCAAGAATTTGTAGAGAGCATATCATTCTTACTTGGAGCACGACGG AAACGGTGAAGAGCAGGCAGGCCAGTGTAGAAGTCCGTGTCAAGATTTGG TGATGATGTAATGATTGCTGAGTTGATC Allele pk5012 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK5012_L Allele pk5012 1 0 Tc1 Clone pRPRC7 Clone pRPRE12 Clone pRPRF1 Clone pRPRF8 Clone pRPRF9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5012_L TATATAGTTATGAACTTGTGGATTCCCTGCCCTAAAGGCCTGCGTACAGA GATTCAAAGTATTGCATCGATGCCACTTTGAGATTTTTTCTTACTATGAC GGTTCTACCGTGAAGGGCACGAGTCAGATC Allele pk5013 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Strain KR1787 Strain RW7000 Sequence PK5013_L Allele pk5013 1 0 Tc1 Clone pRP10C8 Clone pRP11C7 Clone pRP11D11 Clone pRP11D2 Clone pRP11F2 Clone pRP7A4 Clone pRP7D12 Clone pRP7D8 Clone pRP7E8 Clone pRP7G4 Clone pRP8A9 Clone pRP9A9 Clone pRP9H11 Clone pRPRA9 Clone pRPRC2 Clone pRPHD7 Clone pRPKH1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5013_L TAGATGGTGTCAGGCTGTCTTATCACAGTTTGATC Allele pk5014 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK5014_L Allele pk5014 1 0 Tc1 Clone pRPRD11 Clone pRPRD4 Clone pRPRH11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5014_L TAACTAAGAACATTAACACACTTTTGCAGAACAGCTTTGATC Allele pk5015 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK5015_L Allele pk5015 1 0 Tc1 Clone pRPRE7 Clone pRPRG12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5015_L TATATGATGAGACTAATAAAAGAAAAAACAAGCCCGGCAATTCCAACCAA AAACGAAAAACTTTAAAGCAAAAAAAAAAACGCAAAAATTCAAGAAAAAA CC Allele pk5016 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK5016_L Allele pk5016 1 0 Tc1 Clone pRPRH3 Clone pRPRH4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5016_L TATATTAGGAAGTGGGCGTGACTTGAACTTTCGATC Allele pk510 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK510_R Allele pk510 0 1 Tc1 Clone pRPMA1 Clone pRPMA5 Clone pRPMG1 Clone pRPND3 Clone pRPND6 Clone pRPNE11 Clone pRPPC5 Clone pRPPD4 Clone pRPPH10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK510_R TATGTGGTTTGAAACAATTTTGCGGCGGCTTTTTATGAACCTATTAGGCT TGCTATGTACTCAGCAAGTTGCTCCTCCTGTTGCACGGTCGAGGCGCTCC AGTAACATTTTTTCTCGCGCTTTTTACGTGCCACATTCGCGCTCTAATCG AGTCTGCTCCGTGTGC Allele pk511 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK511_R Allele pk511 0 1 Tc1 Clone pRPMA10 Clone pRPMB8 Clone pRPMC5 Clone pRPMD11 Clone pRPNB6 Clone pRPND7 Clone pRPOB7 Clone pRPOC12 Clone pRPPD1 Clone pRPPF3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK511_R TACCAGCGTACCTGCGCATTTGTACTTTTAAAATGTTAATGTTCAAATAG TTGAAACATAGTTAGGTAGACATCAAAAATTACTTTTTAAATTTTTTTTT CATCATTTTTTTGAATGTATTAGATC Allele pk512 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK512_R Allele pk512 0 1 Tc1 Clone pRPMA11 Clone pRPMB10 Clone pRPMB7 Clone pRPMD2 Clone pRPMD3 Clone pRPMD6 Clone pRPNA11 Clone pRPNC7 Clone pRPNE7 Clone pRPNE8 Clone pRPNF8 Clone pRPOC8 Clone pRPOF7 Clone pRPOH3 Clone pRPPE7 Clone pRPPE9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK512_R TATGTGATTGGTTTAAAAAATTTAAAAAATTTGAAAGTTCAAAATGTTAA CACATAAGTATCAATCAGGTGCAAATATTACAATTTGAGTACATTTTTTC AAAAGCTCATGACCTCACATACTTAAACACAATGATC Allele pk513 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK513_R Allele pk513 0 1 Tc1 Clone pRPMA7 Clone pRPMD8 Clone pRPMF5 Clone pRPNC6 Clone pRPNG6 Clone pRPOD4 Clone pRPOG3 Clone pRPPE3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK513_R TATATTCAATGTCGGGAGGATC Allele pk514 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK514_R Allele pk514 0 1 Tc1 Clone pRPMA9 Clone pRPME10 Clone pRPMG4 Clone pRPNB7 Clone pRPNF6 Clone pRPOG10 Clone pRPPA10 Clone pRPPB11 Clone pRPPD8 Clone pRPPE12 Clone pRPPF4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK514_R TAGAATTACTTGATTTCAGGCGAACTTCACAGCGATC Allele pk515 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK515_R Allele pk515 0 1 Tc1 Clone pRPMB11 Clone pRPME11 Clone pRPME5 Clone pRPNA10 Clone pRPNC4 Clone pRPND1 Clone pRPND10 Clone pRPND12 Clone pRPND9 Clone pRPNE1 Clone pRPNE10 Clone pRPOG11 Clone pRPOH7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK515_R TATCTTAGACTAGAAGCGGATTCTTTTAAAGGTTGAGATC Allele pk516 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Strain RW7000 Sequence PK516_R Allele pk516 0 1 Tc1 Clone pRPMB12 Clone pRPMC10 Clone pRPME8 Clone pRPMH11 Clone pRPNF3 Clone pRPNG4 Clone pRPOE4 Clone pRPOE5 Clone pRPOE6 Clone pRPOH12 Clone pRPPF8 Clone pRPPG8 Clone pRPBD5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK516_R TACCTCATAGTAGGCATAGTAGGCACGTAGTAGGTATGCTTGCCTTAAAA CCCAGACACATATTCTGAAGAATAGCAATTTACCGAAACAACCAAGTCCC CGGGAGATGCAGTTTTCTTCGATTCCGGAATGACGTCGTCAGTGTCTGCG ACAGTTGTGCGTACGATGGTGGCGGAGATC Allele pk5017 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5017_L Allele pk5017 1 0 Tc1 Clone pRP10D10 Clone pRP10D11 Clone pRP10G7 Clone pRP11E1 Clone pRP8C8 Clone pRP8H1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5017_L TATCTATTTTCGATTCTCGAAATATAGTTTCCATGGCAGATTTCAGAATT GAAAATGAATCTCTTAAAACTGAAAATGCAGTTTGTCCGAGTCGACATCC AAGTGATC Allele pk517 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Strain RW7000 Sequence PK517_R Allele pk517 0 1 Tc1 Clone pRPMB2 Clone pRPNC3 Clone pRPND4 Clone pRPNE2 Clone pRPNG5 Clone pRPNG8 Clone pRPOE8 Clone pRPOF8 Clone pRPPA9 Clone pRPPC6 Clone pRPPE11 Clone pRPPE2 Clone pRPPF12 Clone pRPPG1 Clone pRPJF1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK517_R TATGTTTATATTCAAATATTAGCTCTATTAAGGAGGTGTTTACACATACA AAACGTACTGCTGTACTGCTATGATGATC Allele pk518 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Strain RW7000 Sequence PK518_R Allele pk518 0 1 Tc1 Clone pRPMB4 Clone pRPMB5 Clone pRPJG1 Clone pRPSB2 Clone pRPSE2 Clone pRPSF1 Clone pRPSH10 Clone pRPTF11 Clone pRPUB2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK518_R TACCCGGGATCCTCTAGAGTCGACCTGCAGGCATG Allele pk519 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK519_R Allele pk519 0 1 Tc1 Clone pRPMC1 Clone pRPME6 Clone pRPME7 Clone pRPNC12 Clone pRPND5 Clone pRPNF1 Clone pRPNF2 Clone pRPNF7 Clone pRPOD1 Clone pRPOH10 Clone pRPPE6 Clone pRPPG2 Clone pRPPH3 Clone pRPPH9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK519_R TATGTTTAAAAAGAAGCGTTTAAAAAATTGGGTTAAGTAAAAATTATCTT CCAGGCGGTAGATTCACCATGTGTACGCTGTGATC Allele pk520 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK520_R Allele pk520 0 1 Tc1 Clone pRPMC11 Clone pRPMH8 Clone pRPNB1 Clone pRPPD5 Clone pRPPF9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK520_R TATCATCGCTGCATCTTGATTTGAATTGAAAAAATAGATTAAAAATGAAA ATTACGAAAATAGCTTAACAAACTGTGATATCAATAAAAAATAATGCGTT TGAATATTTTGAATCTACACAAATCGACAGC Allele pk521 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK521_R Allele pk521 0 1 Tc1 Clone pRPMC4 Clone pRPNH2 Clone pRPNH9 Clone pRPPD10 Clone pRPPE4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK521_R TAGGGCTTTCCATTTGGAGCAGAAGTTTCTGCCGTTTTTCTTCACTTTTT CTCCGCCTCACGTTCCCATTCCCATCGTTAATTTGAATCGTGTGGGTAGC ATCTGGAAAACATGATATTATTTGACAACTTTAGGTGATC Allele pk522 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK522_R Allele pk522 0 1 Tc1 Clone pRPME1 Clone pRPNB2 Clone pRPPB8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK522_R TATACAGAAATAAATATATTATTGTAATCCTGTAGTAAATCAGATGACAG ATATTATATCAGTTGACATTTTTTTGATAAACCTAAAGACGGCTAAGATA TAAGCATGGCTTATCGATGCACCATGTTTTGATC Allele pk523 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK523_R Allele pk523 0 1 Tc1 Clone pRPME12 Clone pRPMH5 Clone pRPNC1 Clone pRPOD12 Clone pRPPH6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK523_R TAACTGACCCAAGAATATTTTCCTGTACTTTTTGTATTTATTTCTTTTGA AAATGATAATTTAATTGAAACGTCAAATTGATTTACATTTTTAGGCTTTG TAAAACACTAATTCTTGATTGAACAAACCGAAACTTAATCAATTTAAATC GAAGTTTAACAGTTTGATAAA Allele pk524 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK524_R Allele pk524 0 1 Tc1 Clone pRPME2 Clone pRPOB12 Clone pRPOD7 Clone pRPOD9 Clone pRPPA1 Clone pRPPC2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK524_R TATATACCGTATTTTCCCTACTGAACTAGCACCTTTTTAGAAATCTATTT TGATGGCTTATACGTATCTATATTGTCTGTGGTGATATCAAAACATGTTT TAATATTTTGTAAAAATTTTTGTCAATTATAAGTTTTTGACAAACTGTCA ACGTGGAGCTAGAAGGGTGCAAGTTTGATAGAGAAAATGCTGTAAGAAAA TGCGGTAAC Allele pk525 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK525_R Allele pk525 0 1 Tc1 Clone pRPME9 Clone pRPOD8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK525_R TAGGCAAAACCCCCCCCATTGATC Allele pk5018 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Strain RW7000 Sequence PK5018_L Allele pk5018 1 0 Tc1 Clone pRP10D4 Clone pRP11E4 Clone pRPGC7 Clone pRPHG3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5018_L TAACTGTGTTGCAGCAGTTCTGACTCACGATC Allele pk526 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK526_R Allele pk526 0 1 Tc1 Clone pRPMF2 Clone pRPNF10 Clone pRPNF5 Clone pRPOA9 Clone pRPOD5 Clone pRPPB2 Clone pRPPC9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK526_R TATGTATGTGTTTAATTGTGGAAATTTTTAGCCAAAATGTTGATC Allele pk527 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK527_R Allele pk527 0 1 Tc1 Clone pRPNA1 Clone pRPNE3 Clone pRPOC9 Clone pRPOG8 Clone pRPPB10 Clone pRPPH4 Clone pRPPH5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK527_R TACGTATATCAAGCCGAAATAAGTCAACCAGAAAATTGTGCTGAATTTAG AAATTAACACAACAAGTTTCAAGTTCCGACGGCGAAAAAAAAATTGCCGT TAAAAAAATTAAATTTACCTTTTTCCGTATCCACCATTGCGACAAACCAA TAGCCATCATAAGCCTGACTATA Allele pk528 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK528_R Allele pk528 0 1 Tc1 Clone pRPNB12 Clone pRPNG3 Clone pRPOB5 Clone pRPOC4 Clone pRPOE10 Clone pRPOF4 Clone pRPPA6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK528_R TATGTGCAAATTTTTTAAAGGAGAAAGGAGAAAGTTTTTTGTTCGAATAA CACTTATAAAAATTTCAACAATGAATATGAAGCTTTTCTACCAGAAATGA ACCGCGTCCAATCTCTGGCACATCGCAAAAATCTGTTCTAGAGAGAAAAA CTGATTTCCTCACAATGAGCAGCGCTATCTACCTTACCTATCTCCACCGA ATTTAATATCAACCTTTCAAAATATCTTTAGTGAACAAAA Allele pk529 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK529_R Allele pk529 0 1 Tc1 Clone pRPNB8 Clone pRPPD2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK529_R TATCTCTTGATTTAAGAACACAATATACACACTTTAAAATCACAAAAGGG CACAAAATCTACACAATAAAAACTCGAGACAAAACACACAAAAAAAACAC AGACACAAAAAACCCGTGCACAGTGATATTCTCTCAAAAATTATATGTCG CCCCACGACTTCT Allele pk530 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK530_R Allele pk530 0 1 Tc1 Clone pRPNB9 Clone pRPNF4 Clone pRPOC2 Clone pRPPG10 Clone pRPPH8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK530_R TACATGCAAGACTCTCATCTTCCAGGACTGGGCTGCCAATCAGCCGACCA ACAATGCCGGAGACGACTGCGCAGTTTTACTTGCATCCACCGAAGCTTCT GGATC Allele pk531 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK531_R Allele pk531 0 1 Tc1 Clone pRPND2 Clone pRPPB6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK531_R TATCTTTGCTCTTTTTTATCAGCAGACTCGTTATCTCTGCCAAATGTGGC AAACAATTTTTCGATC Allele pk532 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK532_R Allele pk532 0 1 Tc1 Clone pRPNE9 Clone pRPOE1 Clone pRPOE11 Clone pRPOF6 Clone pRPPG11 Clone pRPPH7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK532_R TACTTCGTGTATTGTTATATTTAATGAAAAAAACGCTCAAAGTTAACATT GATTTAACGCGTTGATTCATGGGATTGCGTATTCGAATAAAGTAGTTTTG TTTTAGAAGCTTAACTATCCTAAAACAAAATTCTTCATGATC Allele pk533 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK533_R Allele pk533 0 1 Tc1 Clone pRPOA11 Clone pRPOG4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK533_R TATATTTCAGACCAATTAAACAACCGCCAATAAGAATTGAACA Allele pk534 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK534_R Allele pk534 0 1 Tc1 Clone pRPOA8 Clone pRPOB4 Clone pRPOD11 Clone pRPOF9 Clone pRPPG6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK534_R TATGTATTATGAACTTCAAAGATAAACCCAAAGTTTTATTTCAGAACTAT TGCGGATC Allele pk535 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK535_R Allele pk535 0 1 Tc1 Clone pRPOB1 Clone pRPPA12 Clone pRPPC8 Clone pRPPF2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK535_R TAGCAGAACATGATAAGAATGATGACAGACTGTAAAAAACAACTGATGTT GAAGCGATC Allele pk5019 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5019_L Allele pk5019 1 0 Tc1 Clone pRP10D5 Clone pRP10F10 Clone pRP11E2 Clone pRP7B9 Clone pRP7E5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5019_L TACATTCTTGTCTCCGTAGAACGAATAGCACTTGCAGACAACCTTCATGC ACCAGACATGGACGAGAACTCCTGTGAAATGAATAAGAATGGCTGAAGCT GGATTCTCTCCATTCATATTCTGGTACGACTTGGTATCCACAAAGTTGAT GATATCAAGTGATATTTGGAAGATTGCCAAGAATAAGG Allele pk536 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK536_R Allele pk536 0 1 Tc1 Clone pRPOC6 Clone pRPPC11 Clone pRPPC12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK536_R TAAAGCAAACAATTGTTTATCTACAAAAATTTGGAGATTTTAATTTTTTG GACTATTATCGGTTTTTCGTAAGTGTCCGTAGTGGAAAAACATTTTGGAA ACTTTTTCATTTTTATTTTTTCGGAAAAGTCTTACTTTTTTAATACTACC TAAGATTTTAGAAAACTGTTTTACCTTCAATTTACAAATGTTTAGCACTT AAAATCCCAAAGATC Allele pk537 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Strain RW7000 Sequence PK537_R Allele pk537 0 1 Tc1 Clone pRPPA11 Clone pRPUH1 Clone pRPWH5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK537_R TACCAAAAATGTGGTGAAAGGGGAAGAAAAAGAAAAAAATTCTCAACTAG TATTATATTCTCTACTATCTACAAAAGCCGCTTTTTTATAATGAAACAAA CAACGAAGATCTTTTTTATAATAGGAGGACA Allele pk538 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK538_R Allele pk538 0 1 Tc1 Clone pRPPA3 Clone pRPPC10 Clone pRPPG9 Clone pRPPH11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK538_R TATGTACAAATCTTTTTCTATTACGAACAATGTGCCGTTTCGAGACCGAC CACCGTATTTTGTTGCAACATCTTTAAACTTTTGAACAAAATAAATGTAT GTTTTGGTAGGATGCCATTTCGTAAAACCTTTAGTTTTAGCCTTTCCCAT AAAAAGGCTCTTACCTGCAAT Allele pk539 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK539_R Allele pk539 0 1 Tc1 Clone pRPOH1 Clone pRPOH2 Clone pRPPA8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK539_R TATATTCCATTTTTCTTCATTTCTTCGTATTATTTTTTTAAAGCCTAATT TTAATATTCTATCGAAAATCGAGCCCGTAAATCGATACAAGCGCTACAGT AGTCATTTAAAGAATTACTGTAGTTTTCGCTCCGAGATATC Allele pk5020 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5020_L Allele pk5020 1 0 Tc1 Clone pRPE13 Clone pRPGB10 Clone pRPKD4 Clone pRPLE9 Clone pRP1C10 Clone pRP1C12 Clone pRPYB2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5020_L TAGCTGGGAATAATTATTGGTCCCCAGTCCACCAACTTGTTTCATTGAGG TTCTGCAGAAAATTGCGCCTTTCCGTCAGAACACATTTCCAAGAAACTTG TGCCCTTTTGATC Allele pk5021 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5021_L Allele pk5021 1 0 Tc1 Clone pRPFD11 Clone pRPGD3 Clone pRPHB10 Clone pRPKD7 Clone pRPYD2 Clone pRPZH11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5021_L TACTTTAGAGCCAGTGTCACCACACAACAACTCGAATCTTCATCACAAAC CGACACGACTCTCACAGCTTGGTTTAAGATC Allele pk5022 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5022_L Allele pk5022 1 0 Tc1 Clone pRPFD2 Clone pRPKF5 Clone pRPLF4 Clone pRPLF8 Clone pRPKA4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5022_L TAATTAAACTCTAGGAAAACCAGTCAACTTTTTCTTCTAATATTTTTATA TCACTTTCCTAATCCCTACTAATCAGTTCGAAGACACGATTCTCGAAGAA GACGAACTTCCCGATC Allele pk5023 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5023_L Allele pk5023 1 0 Tc1 Clone pRPFD3 Clone pRPFF7 Clone pRPGD12 Clone pRPHB1 Clone pRPHC4 Clone pRPHG4 Clone pRPKB5 Clone pRPKH8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5023_L TAGTTAAGAAAAGTCAAAAACACCCGGTTTTCTATTTTAAATTTGTACTG TCCTGGTAAACGCGTGAAATGATC Allele pk5024 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5024_L Allele pk5024 1 0 Tc1 Clone pRPFD4 Clone pRPHC6 Clone pRP1B5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5024_L TATGTGTAATGACGATATTGTCGGGTTCAAGTGAGGATC Allele pk5025 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5025_L Allele pk5025 1 0 Tc1 Clone pRPFD7 Clone pRPHC1 Clone pRPKG6 Clone pRPKH10 Clone pRPLC7 Clone pRPLF3 Clone pRPYF4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5025_L TATGTAGAAGCGTTTTGTGAAGTTGCGTCACATGCATATGGGGGTCCGCA ATGGCAACCTTAAATTTTTGGAGTTTACGCAAGATTCTATAAAGTCTACG CAAGACTCCACTAAGCATACCTTATCGAAAACCGTTCTCGCCAGGCTCTC ACAAGAGTCACCAAGTTAGCCGTCGACCAATTCGACACATCTCCATCCGT CACAACA Allele pk5026 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5026_L Allele pk5026 1 0 Tc1 Clone pRP10D7 Clone pRP10H6 Clone pRP7D10 Clone pRP7E10 Clone pRP7H8 Clone pRP8B3 Clone pRP8C1 Clone pRP8H6 Clone pRP9G10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5026_L TACGTTCGAAAATTTCCACCAACTACTATAGATACCAATCACTTCCATAA ATAAACGGATGTATAGGGAACTACCCGACCGTAATAAAAACGTACATAAA TGAGAATAATGTTGTGGGACAAGATGGGATTTATGTCTCAATTACTAACT ATAGGAACTGGTGTATTCCCTTCAATGCCTGATC Allele pk5027 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5027_L Allele pk5027 1 0 Tc1 Clone pRPFD8 Clone pRPGE4 Clone pRPGF1 Clone pRPHC5 Clone pRPYH6 Clone pRPZC3 Clone pRPZG3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5027_L TATGTTCAAAATTTGGTTAAAATTCACCAACTTAAGAAAGAAAGCATACT AGGTTTGCATTAATTTTTAAAAAGTACCATGTAGGTATAGAAGGCAACC Allele pk5028 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5028_L Allele pk5028 1 0 Tc1 Clone pRPFD9 Clone pRPGH12 Clone pRPHC3 Clone pRPKG11 Clone pRPLA11 Clone pRPLC12 Clone pRPZH9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5028_L TATGTCAAAAACCCCAACTGTTGGGACATCAAGAGGACACTTGTACTTTT TGATGAGTAAAAAAAGAAGAAAAAATCTCTTACCTTGATGCTCGGATC Allele pk5029 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5029_L Allele pk5029 1 0 Tc1 Clone pRPFF2 Clone pRPGF6 Clone pRPGH2 Clone pRPHD11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5029_L TATAAAAATAATGTAACCCTTAAAGATAAAAAAAAAAATGTTTTAATAAA AAGAGAATATAAAATAAAAAAATTATAGAAGATTAAAAAAAAAAAAATAT AATAAAAAAAATGTAGCGCAGTGGGGGTCTCCTACATTTTTCCCCCCCCT TATAATATTTGTTGTATCA Allele pk5030 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5030_L Allele pk5030 1 0 Tc1 Clone pRPFF4 Clone pRPHH9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5030_L TATGTCGTTCATTGTTCAAATTAACTTCAATTTTCAACCACTCAAAAATA TGTCCACCTGTTCAACATTTGAATTTTGGAATCTATTGCCTGAAGAAATG AAGTTGGAGTGCATCAAGAATATGTCATTGATAACTCGGTAGGTCCATTG TTTTTTTTTGGGGAAAAAAAATTTGAGA Allele pk5031 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5031_L Allele pk5031 1 0 Tc1 Clone pRPFF6 Clone pRPGC11 Clone pRPHB8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5031_L TAGCAAGAACGCCACTCAAAGCGGCGGTTTAAATTTTTTAAAAATTTAAA AAAAAAAAGCAAAAAATAAAACACGAC Allele pk5032 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5032_L Allele pk5032 1 0 Tc1 Clone pRPFG2 Clone pRPHF7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5032_L TACATTCTTTCAACAAACCCGGAAAAAAACATATAGGGAAAAAAAAAAAG CGAGAGAAAACACTTTTGTCTATACCCCCTGGAAAAAAAAATGTGATAAA ATATATGAAAAATGCGCGAGAAAAAATATAGAACGTCAAAAAAAAAAAAA GA Allele pk5033 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5033_L Allele pk5033 1 0 Tc1 Clone pRPFG9 Clone pRPKG9 Clone pRP1E12 Clone pRP1F3 Clone pRPYB11 Clone pRPYB6 Clone pRPYD6 Clone pRPYE5 Clone pRPZA1 Clone pRPZA4 Clone pRPZE7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5033_L TATACGGAGCGAGTACGGCCCTTATTTATTTTTCAGGAATACATAAGTTA ACAATGTTTAAAAATTGATATATTG Allele pk5034 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5034_L Allele pk5034 1 0 Tc1 Clone pRPGA2 Clone pRPGB9 Clone pRPGE1 Clone pRPGE12 Clone pRPLA2 Clone pRPLC9 Clone pRP1D2 Clone pRPYD12 Clone pRPZA11 Clone pRPZD9 Clone pRPZE6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5034_L TATGTCGTCCCAACGCTGAATGGAAATTTCACAGTACCTCGAATTTTCAG ATTAAATATTTCCGACCAAAGAAATTGAAACTTTAAACATGTTGGTTAAA CATATCACATAAGAATGCGTGTCGAAGCCTTTCACCATCTCAATATTTTC AATGTTGGTCTGTTACGCGTGAATTAGTTGAGAAAAATCCGGGATC Allele pk5035 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5035_L Allele pk5035 1 0 Tc1 Clone pRPGA3 Clone pRPKF7 Clone pRPLA1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5035_L TACATGCATTATTTGCAAAAAACAAATTTGGGTGGAAACAGGGTAAAAAA GGCTGCTGAAATACTCTCACTATACTTAAACTCTCAACTCTTTCAAATGC ACATTTTACCCCTAAAAAAAATCTCAAAAAAAAAAAACTCTAAATGTACA TA Allele pk5036 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5036_L Allele pk5036 1 0 Tc1 Clone pRPGA6 Clone pRPHG6 Clone pRPHH12 Clone pRPLC10 Clone pRPLF10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5036_L TACATGGTTAGACAAACACCGAGATTGTGATTCCCGACGCAAATGTTGTG TAAGTTGCTGTAATTTTTTTGATGATGATTTCAAACAACAAACATATTCT AGAAGCTCTTTGGATGAACTTATCGACTTCACATTTGGACCGCTCTACAC AGAGATTCCAAATTTGAATGGCATCATTTTGACTCCAAAAAAAGCAGACG TGGAATATATCAACTTGAAAATTATGGATC Allele pk5037 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5037_L Allele pk5037 1 0 Tc1 Clone pRP10D9 Clone pRP10G8 Clone pRP11A1 Clone pRP7G1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5037_L TACATATTTTACCAAGTGGCAATTTAATCAGCTCTGACCTCAACACCAGA AATGGGCAAAAAACGATAGCGGGCACTTGATGTGTATCGCATTTCTGTGC ACAGCCCAGTGTCACACCAAAATCTCTGTCACCAAACAGCCCCCGACCAC CCGATTACGTCATCATTGTGTGAGTCCTTC Allele pk5038 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5038_L Allele pk5038 1 0 Tc1 Clone pRPGA7 Clone pRPGC9 Clone pRPHG2 Clone pRPKG2 Clone pRPLB1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5038_L TAGGTTTGCAGGAAATGGCAGAGGTAGTGTTTAAAATTTCAAAAACTGAT C Allele pk5039 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5039_L Allele pk5039 1 0 Tc1 Clone pRPGA9 Clone pRPKD10 Clone pRPLG3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5039_L TAAAGGGAAAATGAGATTCAGGTATGATTTCAACAGGATTTAGCAAAAAT ATTTAGATTTGGGGAGTTCCATTATTCGACGAGTAGGACAATGGCGCGCC TTCGACGATATGGTGAGATGGTGTGGAGTTGGCTGAATTTGGAGCAGCAG GAGCCGCAGAACCAGAAGCTGGAGTTTCTGGAATCGAAGATGGCGTTGAA ACGGATC Allele pk5040 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5040_L Allele pk5040 1 0 Tc1 Clone pRPGB3 Clone pRPZD5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5040_L TATATATTCTGTAACCCTAACCTACAATCATTATTACTTCCTCACTCACT TTCTTCAACAAACAGCAGAAAGAAGGCCAATCAAGTGAGACAAAAAAGAC GAAAGAAAGATTGATCGCACGTAGACAGACAGACTGGCTAGCTACGTACT GTGAACCAACCGTAAGTAATCTCCA Allele pk5041 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5041_L Allele pk5041 1 0 Tc1 Clone pRPGB6 Clone pRPGD11 Clone pRPHE12 Clone pRPKF6 Clone pRPKH7 Clone pRP1E1 Clone pRPZE12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5041_L TATATACATATATGTACAACAAGGTCACGTCACCTTTATGAAGATTGGAT TAGTCGTTGATAAGAGGAGAGCCGCGCTGTTATTATCAGTCTGCTGACGT TGCGAGAAGAGTAGCTTCTAGGCGAAGTGACGGTAATCCCGGAGATTACC CCCACGAAAATAGATGGACAGGATGATC Allele pk5042 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5042_L Allele pk5042 1 0 Tc1 Clone pRPGB8 Clone pRPHB5 Clone pRPYG3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5042_L TATTCCCAAGGGCCAAAAATTTTCAAATAGTTAAACGAGACTTAACAATT TATTTAAAATTTTTTAAAAAAATTAAATTTTAAAAACC Allele pk5043 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5043_L Allele pk5043 1 0 Tc1 Clone pRPGC10 Clone pRPKG7 Clone pRP1B2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5043_L TATATAGTAATGATTTTCAGCTCACCATCTCCGCCTCACGCTGGCAAGAC GTCTCGTTTACCGATGGAATCAAGATC Allele pk5044 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5044_L Allele pk5044 1 0 Tc1 Clone pRPGC2 Clone pRPKC2 Clone pRPKD1 Clone pRP1E5 Clone pRPYF3 Clone pRPZG1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5044_L TATTTCAAAATTCACACAAAAAACCAAAAATGCTAATAAATATGGGAGCA TAT Allele pk5045 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5045_L Allele pk5045 1 0 Tc1 Clone pRPGC4 Clone pRPHF9 Clone pRPKD2 Clone pRPLD2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5045_L TAGGTCTTCCGCCGAAACAAATTACAGATTCTGAAGCCCAAAAAGCCAAC CAACCCAAAAAAACGTTAACTTTAACCCAAC Allele pk5046 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5046_L Allele pk5046 1 0 Tc1 Clone pRPGC5 Clone pRPGE7 Clone pRPKH3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5046_L TACCTTTCGTTTTCTGTAATATGCTACTTCATTTTGCATTTTTGTTTTGC ACTTAAGTAAAAAAAAAAATAAAAATGGTGTACTATTATGACAACAAAAA ACGAAAATTGCCGGAACTCGGGGTGGGCACCACCACCACTATTATAAAAA GAAAAC Allele pk5047 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5047_L Allele pk5047 1 0 Tc1 Clone pRPGD1 Clone pRPHF4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5047_L TAAAAGGGAAGGTTTTGGCCGGCAAAGGCCTGGTCAAACCAAAAATTCAA AATCAAAAAAACTCAAAAAAAAAACCTTAAAAAAATCCCCAAAATTTTTT TCCGAATTTTCAAAAATTTCAAGAACAACCCGGGTAACAACCTTCCGGGA AAATGCCCCAAAACAACGGCCCAAACAACC Allele pk5048 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Strain KR1787 Strain RW7000 Sequence PK5048_L Allele pk5048 1 0 Tc1 Clone pRP10E1 Clone pRP11D12 Clone pRP11E9 Clone pRP7E7 Clone pRP7F9 Clone pRP8E9 Clone pRP8H8 Clone pRP9A11 Clone pRP9A6 Clone pRP9C8 Clone pRP9D2 Clone pRPRE3 Clone pRPRE4 Clone pRPRH9 Clone pRPGG7 Clone pRPKB11 Clone pRPKD6 Clone pRPKH4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5048_L TATGTGACCCGAGTGAGAGAAGGAACAGCAGTTGAAATACAGATAAATTT TGGCAAACAGCCTTGCAGAACCCCAGTCATTGATC Allele pk5049 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5049_L Allele pk5049 1 0 Tc1 Clone pRPGD10 Clone pRPLD8 Clone pRPYF8 Clone pRPZG4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5049_L TAGTTTTGCAATCCCCCACGCAAAATTTTTTTTTCGTCTGCGCTTTAAAG AAAAAATAAAGCAGTTATAAAAAGATTAATATTTTTTTGTGAGCAGATTG AAAAATTGTGTGTCTTCATATTAGAAGCGGTATTAAAAT Allele pk5050 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5050_L Allele pk5050 1 0 Tc1 Clone pRPGD4 Clone pRPLH4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5050_L TAAAAAACACACAAATTGAACAACAACTCTAAACAAACAAAGCCCCTCAA CTAACCAACCAAAAAAAAGCCCGAACCTTTAAGTTTTAACAACAACAACC GAAGCTGGGGGGCAACAAAAGAAGGGAAAAAACCAAAGGAAAAAAAGAAA AAAGTGGAAAACCGAACC Allele pk5051 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5051_L Allele pk5051 1 0 Tc1 Clone pRPGD6 Clone pRPGD7 Clone pRPKF12 Clone pRPLE12 Clone pRPLE3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5051_L TATCTCGGTCATGTTTTATTTCAGTCAGAAAACTTTAACTGAGATC Allele pk5052 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5052_L Allele pk5052 1 0 Tc1 Clone pRPGE11 Clone pRPHD8 Clone pRPHE8 Clone pRPHG1 Clone pRPKE8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5052_L TATATTAGCAAAAATTGAGTTATTTCTAGTAGATAAACAAATTTTGGTCA CAAATGCAACATGGATTCCGCCCCAGAAAATCAACGGTGACTAATATGTT AGAATCTTTGAATGATTGGACTAAAAGTATTGATC Allele pk5053 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5053_L Allele pk5053 1 0 Tc1 Clone pRPGE5 Clone pRPKE10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5053_L TAGATGACGGAAGAAGAGGCGATCa Allele pk5054 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5054_L Allele pk5054 1 0 Tc1 Clone pRPGE8 Clone pRPYH5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5054_L TATGTCAGCTTGTAGGTTGGa Allele pk5055 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5055_L Allele pk5055 1 0 Tc1 Clone pRPGF10 Clone pRPKG5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5055_L TAGTTGATGTATTTAAGAAAATAAATTCCAAAACACAAGATTGAAAAGAA AACATATTTGTGGAGACACAAGAAAACTCAAAAAAAAAAAAGA Allele pk5056 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5056_L Allele pk5056 1 0 Tc1 Clone pRPGF11 Clone pRPGG4 Clone pRPHH4 Clone pRPZG8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5056_L TACTAGAATAGAAAATAGGTTAGACAATGACAAAATATTTAGGATTGTAT AAAACAGCTGTCACAAAATGTTCACATTTCAAAAAATAAAATGACTGTTT TGTTGATATATATTACTGGAAAGCAGTTGTTTCTTACCACGGAATATGTT GCAATTCCACATGTATCTTATTCCTTTTTAATCTGAATGTGTACTACA Allele pk5057 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5057_L Allele pk5057 1 0 Tc1 Clone pRPGF3 Clone pRPKF11 Clone pRPKF9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5057_L TATGTTCAAAATTTCCCATGTGTAGCCGGTGTATCTATACTCGGATTCTT CGAAAGTCGCTACAATGCTATCGTTAAAAGAAACCGAGGGTCAATTTTCA AGACTAAAGGTAGATTGTTGTATATTGTATTACATTATACCTATGCATTT TGTTTCACACTTCC Allele pk5058 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5058_L Allele pk5058 1 0 Tc1 Clone pRP10E10 Clone pRP10E11 Clone pRP10E9 Clone pRP10F4 Clone pRP11A9 Clone pRP11B12 Clone pRP11E5 Clone pRP11F6 Clone pRP7A2 Clone pRP7A8 Clone pRP8B8 Clone pRP8E1 Clone pRP8E11 Clone pRP9G1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5058_L TATGTTTGGAATTTGTTGCGAATAGATGTCGCGAGTTGGTAATGCATACC CAATGATC Allele pk5059 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5059_L Allele pk5059 1 0 Tc1 Clone pRPGF7 Clone pRPKB3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5059_L TATAAACGTGAGTTTAAAGAAACACTCTGGAAAGGTGAAGTTCGGAAAAT GGTGATTTAGTTTTAAAATACTCAAAATATTCCATTATACTAGGGCTCCC AGTTCAGTGTGAGGCGCAAACGCGGCCCCAACCCCAAAATTTTGAAACCG CCCAAAAAATCCGGGGTCCCAAACCTGGCCGTAAACGTGTGCGCAACGTA GCCGGAGATCCC Allele pk5060 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5060_L Allele pk5060 1 0 Tc1 Clone pRPGF8 Clone pRPLD10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5060_L TATTCATTCAAAATGGCGCCAAAAGACAATGAACCAAAAAAAACCGTTCC CCGGCCGCCCCCAAACCTTAAGGCCCCCCGGTCCCCCCCCCCCCAACTCA ATTAACCCCCGGGCAAAAGCCTCCTTGGGGTCAACCAAAGGTCCG Allele pk5061 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5061_L Allele pk5061 1 0 Tc1 Clone pRPGG11 Clone pRPLD9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5061_L TAGTTGGCTCTCAACGTAGGATGCGCAGAATTGCTCCCCGAAAACAATGG TCCCTGCAAAAGGACTAACAACTCAAACAAATTGGCAACCGCCGAACCAA AAAGTTAACCCGAAAATGGTGCCAAGAAAAAACC Allele pk5062 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5062_L Allele pk5062 1 0 Tc1 Clone pRPGG6 Clone pRPHD10 Clone pRPLG11 Clone pRP1C4 Clone pRPZE11 Clone pRPZE4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5062_L TATGTTAAATCAGAATACACAATACGGATAGAAACGGGCTGAACATGTAA AGGGTCATTGATACAAGTCTAACATGTAAATTTTATTTTTAAAGTAACGA TC Allele pk5063 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5063_L Allele pk5063 1 0 Tc1 Clone pRPGH1 Clone pRPHC12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5063_L TAGTTACTTGTATCATCTTTTTGAATCTTATTCAAGTTTGGAGTTTTCTT GATTAGTAACTCCATTAATCCTTCAGTTGCTGTATATTCTTCACTATCAA CTTTAATAATGTTTTGATC Allele pk5064 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5064_L Allele pk5064 1 0 Tc1 Clone pRPGH10 Clone pRPHC2 Clone pRPKB9 Clone pRPLE6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5064_L TATGTTGTGTTGCTCGGGAGAAGTGATTTATGATGAGGACCTGTCAGGTC TCCAACCGGAAAAAAGGGCAAAAACCCCCGGGAAGAACGAAAAGGAATCC AAAACAAAAAATTTCAACCAACAAAAACAAATTCCCAACC Allele pk5065 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5065_L Allele pk5065 1 0 Tc1 Clone pRPGH4 Clone pRPHF5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5065_L TATGTCTACTAGAAAAAAAACGTTTCAATTCAATTTTTGACGTCACTTAT CAAAAAAAATTAAATTCAAACCCCCAAAGGCCAAAAGAACCAAAAAAAAA CCAAAAAACAAAAACCGAAAAACCCTGGTGCCAACAACCTTTTTAATTGG GAACTTGAAAACAACCAAGTTAACTTCCCGCCGTCCAAAAACAAATAAAT C Allele pk5066 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5066_L Allele pk5066 1 0 Tc1 Clone pRPGH9 Clone pRPHA10 Clone pRPHA8 Clone pRPHD9 Clone pRPHE10 Clone pRPKA9 Clone pRPKG4 Clone pRPLE11 Clone pRP1C1 Clone pRP1E2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5066_L TAGTTAAATTATATTATAATTTTACAGAATGAGAAGTCTTACGCGGAAAT GGTTTTAAGTGTTTTGGAATCCTCTGACAGTATAAATGGATTTTCGCATC ACGCGATAAAGAAAGGCGTTTCTCAAATGATGACTCGGACAATTGGCAAA GGCTTTTCGCGCTATATCTTGAGTGCTCTTCAGAAGTTGGAAAGTCAGAA GATC Allele pk5067 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5067_L Allele pk5067 1 0 Tc1 Clone pRPHA2 Clone pRPHG12 Clone pRPKF1 Clone pRPLA10 Clone pRPLF7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5067_L TACATCTCCGCCGAACTCCGCAAGCTGAAAATAGGTAGGTCTGACTATGA GTGTGGAAAAAAGGTGATC Allele pk5068 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5068_L Allele pk5068 1 0 Tc1 Clone pRPHA6 Clone pRPHH11 Clone pRPLE2 Clone pRPLF12 Clone pRPYG4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5068_L TATATCAAGTTTTTGTTCTTCTACTTACTTCCAATGGGATTGTCACTTCG CCAAGCTCCATCGGTCTTAACCTTTCAGTTGGAGTTACTGTAGCTCCGCC ACATGGTCCAACAGTTACTACCATG Allele pk5069 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Strain KR1787 Strain RW7000 Sequence PK5069_L Allele pk5069 1 0 Tc1 Clone pRP10A3 Clone pRP10A5 Clone pRP10D1 Clone pRP11E6 Clone pRP7A7 Clone pRP7A9 Clone pRP7B12 Clone pRP9A12 Clone pRP9B10 Clone pRP9B7 Clone pRP9F2 Clone pRP9H7 Clone pRPRA3 Clone pRPRC3 Clone pRPRD6 Clone pRPRE8 Clone pRPGA5 Clone pRPGH7 Clone pRPHD3 Clone pRPHH8 Clone pRPLB7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5069_L TAGTCCAACGGCAAGATGGAGAATCAGAAACTACTGAAAATACAATCGAA AAAGTTGGTGTAAGACGTGAAAACCAGAAGAAAATGCGCGACGCGAGATG ATC Allele pk5070 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Strain KR1787 Strain RW7000 Sequence PK5070_L Allele pk5070 1 0 Tc1 Clone pRP10E12 Clone pRP10H12 Clone pRP11C2 Clone pRP7F8 Clone pRP7H11 Clone pRPRG6 Clone pRPRH8 Clone pRP1C5 Clone pRP1E4 Clone pRPXE10 Clone pRPYB1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5070_L TAGGAAGGCAACAAAAAAATAAGAAGAAGGAAACCGTCTATTATCTGGAA AAGAGCTTGAAAATTGGAAATTATGTGTTACGAAAAGCTAATCCACATGA TTTTTCAATGTTTTCAAATATATCTCTACCTTCCCACGCAATGTCTATCG CTTAATAAATTGTAGTGTTGATC Allele pk5071 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5071_L Allele pk5071 1 0 Tc1 Clone pRPHB9 Clone pRPKG8 Clone pRPYH9 Clone pRPZC8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5071_L TATATGGGGCATAGTAGTTATGTTTTTCAGCAGTTTAATATATATGTAAA CTAC Allele pk5072 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5072_L Allele pk5072 1 0 Tc1 Clone pRPHC10 Clone pRPKA8 Clone pRPKC5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5072_L TATGTACTAGCCAAGTTTTGATGTCCGTATCCCAAATCTAAAATTCTGAT C Allele pk5073 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5073_L Allele pk5073 1 0 Tc1 Clone pRPHC7 Clone pRPHH1 Clone pRPKD5 Clone pRPLC4 Clone pRPLG10 Clone pRPLG12 Clone pRPLH12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5073_L TACTCCTCTGGTATTTGCCTCGAGAAAATTTCTGCGTTTTTCATTCTCTA AAAGAGTCTCTTTTGGTTTGCCATTTCTGTTTACTGAACCAATCTCCAGA TGAGGTCCAGATGACAACGACGTTCCTTCTCTTACCAATCTCTTATAATC GATC Allele pk5074 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5074_L Allele pk5074 1 0 Tc1 Clone pRPHC8 Clone pRPYD8 Clone pRPYG9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5074_L TATGAGTTAAGGGTATGTCATTGTAACTTGACAATATTGTTACTGTAGTT GTACCGTAGTTAAAGTCTAATAAGAATTTTGTAAAATAGTGTTAGTAGTG TATAGTAGTGTTAAGATTGTAGTGGTATTGTAGTGGTACTGACAAACTTC CAGGTGGGCTCAATTTACGACACAAAATGCGATC Allele pk5075 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5075_L Allele pk5075 1 0 Tc1 Clone pRPHD1 Clone pRPKE1 Clone pRPKE2 Clone pRPLC3 Clone pRPZH10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5075_L TAGAAAGGTTCAAGTTGAACTTGATGAGAATGAGAAGACTATCAACATTT TCTGGCCAACAACTGAAAAAGAAGATC Allele pk5076 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5076_L Allele pk5076 1 0 Tc1 Clone pRPHD4 Clone pRPLF6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5076_L TACCAAAAGAAAACAAAAGGGGAAACAACTTTTCATAATTCTCACGGCAC CAGCACCCGTAGTACACCAAAATGAAACTGTAATTTCAAAAAAAAAAAAC CCCTTGAAAAAGGCCAAATGGCCCCGGAAGAAAAACCAAAGAAAAAGAAA CTTGAACC Allele pk5077 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5077_L Allele pk5077 1 0 Tc1 Clone pRPHD5 Clone pRPXA2 Clone pRPYE7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5077_L TATATGTGGCAAACATAAACTCAAAGTAAGTATTTCAGAAACTACACTCG GACAAGTCCCGGTCCTATCCGTCGATGGATTTGAAATTCCACAATCTGCT GCAATCATCCGCTATCTTGCCAATAAATTTGGATATGCTGGAAAAACCCC GGAAGAGC Allele pk5078 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5078_L Allele pk5078 1 0 Tc1 Clone pRPHD6 Clone pRPKE6 Clone pRPLE8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5078_L TATATGTTATGACTAAGGGTAATTTGATACATCGATAACAAAATGATC Allele pk5079 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5079_L Allele pk5079 1 0 Tc1 Clone pRPHE11 Clone pRP1A11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5079_L TATGTCAACGGTACATGCGCGGTCCCCCCCCACCACCACCGGCTACTATA GTAGACAAAACATCTGAGGAACCAAAAAAAAAAAAAAAGAAAAAAAAGAA AAAAAACAACCCGGAGGAGAAGATGACAAAACACT Allele pk5080 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5080_L Allele pk5080 1 0 Tc1 Clone pRPHE9 Clone pRPHH10 Clone pRPLB3 Clone pRPLE4 Clone pRP1D3 Clone pRPZF1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5080_L TATGAGAGATTGTAGGTTTGGTGAAGCATCAGATC Allele pk5081 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5081_L Allele pk5081 1 0 Tc1 Clone pRP10E2 Clone pRP11B2 Clone pRP7D9 Clone pRP7G3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5081_L TACATTGTCATGGAAGTCTGGATTAGGCATGTCGGAGTCGATGCCGTCAA ATTCCAAAGCAAGAAGTCCAAGGGATAAGTGGAGCATCTTGATGTTCATA CGGGCTGATAGAGTACGTGATTTTGCGATGAGTAGCATTGTCTCGTATTG TACGTTCGGGGTACTGCAGAACGCATCGAGCGGGAATGTTGGCCGTCGTG TGCGATC Allele pk5082 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5082_L Allele pk5082 1 0 Tc1 Clone pRPHF1 Clone pRPKF8 Clone pRPLH5 Clone pRPZC12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5082_L TAGTTTAATCTTTCGATTTATTATAAAACAAATTTACCTCAGTCTTCAGG ACAGATGAGATTGTTCTTCACAGTTCCAAATGTTTTTTTCCACAACAAAG CTCCATTTTCTTTCAAAGCACTGTGTTTTCCAGTTAAAAGCGATACGAAA ATCGGTGCCCACTCCTTTAATACATCTGA Allele pk5083 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5083_L Allele pk5083 1 0 Tc1 Clone pRPHF2 Clone pRPLB8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5083_L TACTTGTTATATTCTTCAAGTGTTCTGTTAATCAATAAAAAACCTTTTTT CCCCAAATCCCCAAAAAAGGGCAACCGGCCGCCCCAAAAAAAAGGTAAAG TCCGCCAAAAACAATGCAAGGAAGCCCCCTTTTTTTTAATAATATTATCA CAACAGGCCACCAGAAGATCGACCACCAACAAAAAAAGGCAACAATC Allele pk5084 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5084_L Allele pk5084 1 0 Tc1 Clone pRPHF6 Clone pRPHG5 Clone pRPKC1 Clone pRPLA4 Clone pRPLF2 Clone pRPLH7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5084_L TAGGTAGCGAAACATTTCAGAAAAATTGTTGAAAGAAGACATTCAAATTG TAGTAAATATACATTTTAAGAGTAGCAACACGATC Allele pk5085 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5085_L Allele pk5085 1 0 Tc1 Clone pRPHG11 Clone pRPKC11 Clone pRPLD6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5085_L TATGTTTGAACCAGTTTTTTAAAACATTCAATATTTTGTGAGCGTGAAAA AAAAAAAAAATAAAATAAACCAACCAAATGAATATAAAAAAAAATTAAAT AGAAAAAAAAATTAACATTT Allele pk5086 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5086_L Allele pk5086 1 0 Tc1 Clone pRPHH6 Clone pRPKE4 Clone pRPLF1 Clone pRPYG2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5086_L TACATATTTCACATTTAAAATTTTTATATTTTTGGAGCACAAAAAAAAAA AAATATTTGTTGTTCCAAAATAAT Allele pk5087 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5087_L Allele pk5087 1 0 Tc1 Clone pRPKA10 Clone pRPLA5 Clone pRPLC2 Clone pRPLH8 Clone pRPXA10 Clone pRPYG8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5087_L TAGTGAAAAAATATGCAGATTTTTCTCGCCAAGAGCCTTCTGGAGGGAAA AATGAAAAAAAGAAATGAATTTATAGTCGTAATATTTATATGCGTGTTTC TGATC Allele pk5088 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5088_L Allele pk5088 1 0 Tc1 Clone pRPKA3 Clone pRP1D6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5088_L TATATGATTCAAGTTTAAGAAATGGGGTTTATATGCGCATACGCGGATAG AAAAAAAAATGTGCACAGGTCTAAAAAAAAAAAAAAACTGAGAGCACACA CA Allele pk5089 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5089_L Allele pk5089 1 0 Tc1 Clone pRPKB12 Clone pRPLE5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5089_L TAGGTTTGAGGTTCAACTGACAACTTTTTTGAACGGCTATCTATGTATAA CTACTGATC Allele pk5090 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5090_L Allele pk5090 1 0 Tc1 Clone pRPKB6 Clone pRPKB7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5090_L TATGTAGTAGTCTATGCTAACAAAACGAAATAAAAAACACACCCGACTGC CATCATC Allele pk5091 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5091_L Allele pk5091 1 0 Tc1 Clone pRP10E8 Clone pRP11D9 Clone pRP7B10 Clone pRP7C1 Clone pRP8D12 Clone pRP8D6 Clone pRP9E6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5091_L TAGTTCAGTTCTATTGTTTACTATTCCCTCTATTATTACTATCGCATTTC CTATCTGTCTTGTAATAGAGGTCACCGATC Allele pk5092 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5092_L Allele pk5092 1 0 Tc1 Clone pRPKC10 Clone pRPXC8 Clone pRPYB12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5092_L TATGGATTCATGGTTTATTAATGCATCTAATGATCGGTCC Allele pk5093 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5093_L Allele pk5093 1 0 Tc1 Clone pRPKC12 Clone pRPLD11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5093_L TATATGGGGTAACTTTGAAAACCCCTTTCCGGCCCCCCTCCGGCCGAAAA CAAAACCCCAAAAAAAAAATGGAACC Allele pk5094 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5094_L Allele pk5094 1 0 Tc1 Clone pRPKD12 Clone pRP1A12 Clone pRPZH12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5094_L TACTTTGACCTGAATTCTCTGTCTTCTTCGTTTCTTTAAGATACATG Allele pk5095 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5095_L Allele pk5095 1 0 Tc1 Clone pRPKD9 Clone pRPLA9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5095_L TATGTCAATAAGGTCAAAAGGCCTGGAAAGCACGAACGGTACCGTCATGC CCCGTCACCCCACACCCCACGCCCAACGCGCAAAAACAGAAAACAAAGAA TCAAGAAGCGAGCAGCGAGTGGCACC Allele pk5096 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5096_L Allele pk5096 1 0 Tc1 Clone pRPKE7 Clone pRPKE9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5096_L TACATGGGTCCCAAAAAAACGAATTAAAAGCCAAAAAGGTTTTCCGAAGT CCCAACAATAAAACC Allele pk5097 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5097_L Allele pk5097 1 0 Tc1 Clone pRPKH5 Clone pRPKH6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5097_L TATATATATAATTCAAAAACCGGAAGCGCAGAGACACAAAAAGTGTCACA CACAAAACCCCAGA Allele pk5098 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5098_L Allele pk5098 1 0 Tc1 Clone pRPLA6 Clone pRPZF7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5098_L TATATCAAAATCCGAAGGCCTTCAAAAATATGAGACA Allele pk5099 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5099_L Allele pk5099 1 0 Tc1 Clone pRPLB5 Clone pRPLD7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5099_L TACGTGCTAGCATACTATACGAAATTTTAAAAAAAATGGGTGAAAAAAGG GGCAATAAAAAAAACGAAAAACAAAAAACC Allele pk5100 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5100_L Allele pk5100 1 0 Tc1 Clone pRPLC6 Clone pRPYC11 Clone pRPZB2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5100_L TATATTATAGGCATTGGCTAGATCa Allele pk5101 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5101_L Allele pk5101 1 0 Tc1 Clone pRPLG1 Clone pRPZB6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5101_L TAAATAAAACAAAATAAGGCAACCAATGGAAAAAAAACCAACTTTTCCTG GAAAAACCTTAAGTTAATCCTTTTTAAAAACAAGCCCCAAAC Allele pk5102 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5102_L Allele pk5102 1 0 Tc1 Clone pRP10F1 Clone pRP11B3 Clone pRP7B11 Clone pRP7D3 Clone pRP7G10 Clone pRP8E4 Clone pRP9F12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5102_L TAGAAGGAAGTTTTACAAGCACTTTGACATATCAAATTGTAGTGCGTTGT TGTAGGCTAGGTTTTATCATTAAAGTACTGTATTCGCTATCAGGGGAATA TTTATTTCGACCAATTTTCGAGCAGCAGTTAGCTAACAATTTTTCAACCT GCCCAAAATTTTCAATTTTGACAGTTGGGATC Allele pk5103 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5103_L Allele pk5103 1 0 Tc1 Clone pRPLH3 Clone pRPXC7 Clone pRPYE2 Clone pRPZC5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5103_L TATGTCTACATTGTTTATGAGTGAGTTTATTTGATCT Allele pk5104 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5104_L Allele pk5104 1 0 Tc1 Clone pRP1A1 Clone pRP1D1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5104_L TAGCTAGCTGGCTCGGTTAGTGTTAAATAAAAAAAAAAATTTTTGAATAA AAAATAACGGAAAAAAAAAAAAAAAAAAAC Allele pk5105 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5105_L Allele pk5105 1 0 Tc1 Clone pRP1A4 Clone pRPZA3 Clone pRPZD10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5105_L TAGTTGGATGTTACAATATCCACTCCAAAAGTGTTTTAGATTTTTTGTTC CAAAGTTTCAGTCAAATTTTTGAGCAATTTGGATGTATGAGAAATTTTGA TTACTGCTGGTGATTGACACCTGTAGAATGTTTGAGAGGAACTGGTCACA ACGTTATTAAAATGTTGTATAC Allele pk5106 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5106_L Allele pk5106 1 0 Tc1 Clone pRP1A6 Clone pRPYB9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5106_L TACGTGTTAAAATAAAAAAAAAAGCTAACAAAATAAAAAAATAACAAAAA AAAAGAAACAATTCCAACAAAAAGAAAATCCTTAAAAGAATTTAAAATGG TAA Allele pk5107 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5107_L Allele pk5107 1 0 Tc1 Clone pRP1A7 Clone pRP1B9 Clone pRP1E3 Clone pRPYG12 Clone pRPZF5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5107_L TATTATGAAGGAACTAGGGATAAACTATGAAAAACGAGCTTCTAATTGCC CCTCATC Allele pk5108 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5108_L Allele pk5108 1 0 Tc1 Clone pRP1A9 Clone pRPZH2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5108_L TACATATCAGCATAACTATAATGGAAATAAAACCAATTTTTGTTGCAAGG ATTAAATA Allele pk5109 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5109_L Allele pk5109 1 0 Tc1 Clone pRP1B12 Clone pRP1D10 Clone pRPYF5 Clone pRPZB10 Clone pRPZD8 Clone pRPZF11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5109_L TAGATCAAGTGGCGTTTATATTATTCCAAAAATCCCAAAAACCCGTCAAA AAAGGGAAAAAAAGGGAAA Allele pk5110 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5110_L Allele pk5110 1 0 Tc1 Clone pRP1C7 Clone pRP1D5 Clone pRP1D8 Clone pRPYC12 Clone pRPYD5 Clone pRPYE11 Clone pRPYE9 Clone pRPZD11 Clone pRPZG11 Clone pRPZG6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5110_L TATGCAACTGGCTGGAGCATACTCGATCTGCAGTGCCCCCAATTTTCTCA ACAGGAAAAATGAAAGCAATG Allele pk5111 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5111_L Allele pk5111 1 0 Tc1 Clone pRP1C9 Clone pRPYG10 Clone pRPZD12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5111_L TATATCGAACATTGGCATTCGTCTCCTTTCTTTTTCCAAATCCGAATATT ATTATTGCAAAAAAATTAAAAAAAAGACGGAAGAAAAAAAAAAAA Allele pk5112 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5112_L Allele pk5112 1 0 Tc1 Clone pRP1E10 Clone pRPYE4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5112_L TAGGTATTGAAGCAGGCGTGATTGTCCTGAAAAAAACCAAAAAAATAAGC AATTCCAAGGCCAACCGGTAAAACGAAAAAAAAGGGCAATGGTCAAAAAC AAAACT Allele pk5113 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5113_L Allele pk5113 1 0 Tc1 Clone pRP10F11 Clone pRP10H2 Clone pRP7C4 Clone pRP7E11 Clone pRP8B10 Clone pRP8G2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5113_L TATGTACATAAATGGAGAATTTATTTTTGGAAAACGGGTATTACATACAT AAATATCAAATATTCTTACACTTTGAGTAACTCCAAAGCACATATTTGCA GGTTTCACGTCTCGGTGAATGTAACCAAGAGAATGGACATCCCGAAGTGC AGCGCTTTCCTTGGATC Allele pk5114 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5114_L Allele pk5114 1 0 Tc1 Clone pRP1E8 Clone pRPYC8 Clone pRPYE8 Clone pRPZF10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5114_L TAGTGAATGGGCGAAACAAAAAAGAAAAAAAAAAAAAATAAAAAAAAAAA AAGTATGAAAAAAAAAAAAAGGGAAATATGCAAAAATTGTATCATAGACC AAATATAGACTACTGGAA Allele pk5115 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5115_L Allele pk5115 1 0 Tc1 Clone pRPXA11 Clone pRPXB6 Clone pRPXC5 Clone pRPYE6 Clone pRPZA5 Clone pRPZB1 Clone pRPZB3 Clone pRPZB5 Clone pRPZB9 Clone pRPZE1 Clone pRPZG12 Clone pRPZG2 Clone pRPZH6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5115_L TATATTGGCAGACGGTTTCTTATTTTGATAACTAAATAGTCGGCATTTGT GTATTATGCA Allele pk5116 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5116_L Allele pk5116 1 0 Tc1 Clone pRPXA8 Clone pRPYD9 Clone pRPYH8 Clone pRPZC2 Clone pRPZD6 Clone pRPZF8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5116_L TAACTACTGAACTTCCTCAAAATATTTTTAAAAATCCCTATATCTCGTTT ATATTTGACGACTACTGCGGTGGAATAGCTCAGCATCTTATTTTGAACAA TTGCC Allele pk5117 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5117_L Allele pk5117 1 0 Tc1 Clone pRPXB2 Clone pRPYC3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5117_L TAGATCGGCAAACTAAAAGAAGAAAAAAAAAAAACAAATGAAAAAACGAA AAAAGAAAAAGTTTTAAAAAAAAATTCAAAAGAAAAAACCCGAAGGTTTC CAACCAATTCC Allele pk5118 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5118_L Allele pk5118 1 0 Tc1 Clone pRPXC4 Clone pRPYD10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5118_L TATATTAAAAGTTTTCAAAATCACACCCGGAAAAACAAAAACCCAAAAAT AATAGACACACACCCTAAAAATTGCCTTCCGCCAAA Allele pk5119 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5119_L Allele pk5119 1 0 Tc1 Clone pRPYC9 Clone pRPYG1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5119_L TATTTCATTTTCAACAAAACTAAAAAAAAAAAAATTGGAAAAAGAGAAAA GCAAGCAGGCAGGCAGGCAGGAGGTAGAAGCAAGAGACATACAACCAACA TAAAGAAAGGCTGTAGGCACGCACATACACAAAAAAAACAACCCACGACT GCCAGCCACAAAAAAAAAAAAAAAAAAAAAAAACAAAATACACACACTCC ATACATAGACACACCCGGCACCAAAAAAAAAAGGCAACACAAAAAACAAA AAAAAAAAGG Allele pk5120 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5120_L Allele pk5120 1 0 Tc1 Clone pRPYF10 Clone pRPYF9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5120_L TAGACAACGTTGAGTCCAGTTAGTGCTTGGATC Allele pk5121 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5121_L Allele pk5121 1 0 Tc1 Clone pRPYH1 Clone pRPZH1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5121_L TATATAGAGCTATCTTTTAAAGAAGAAAAAATAACCCTTCCACCATTCTG CGCTACATTCTAATTTTGTGCCTATTTCAGGTTCGGGAAGCCAGTATGCA TG Allele pk5122 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5122_L Allele pk5122 1 0 Tc1 Clone pRPYH12 Clone pRPZC11 Clone pRPZH4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5122_L TAGCTCATAATTGTCCGTTTTTCCGCCCCCATAACAAATAATACCTTTTT ACCAATAATATCCTTGTTAACAACTGTT Allele pk5123 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5123_L Allele pk5123 1 0 Tc1 Clone pRP10F12 Clone pRP11C1 Clone pRP11G7 Clone pRP7A1 Clone pRP8F12 Clone pRP8F3 Clone pRP8G12 Clone pRP8H2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5123_L TATAATGATAGGACTCGATGGATGAAGAGGGATTAGGATGTGAAAAACAA GATC Allele pk540 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK540_R Allele pk540 0 1 Tc1 Clone pRPA20 Clone pRPD12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK540_R TTAGCCAACAACGGGCAGGGGAAGGAACGGCAAAATCAACTAACCATATA AACCGGGGGAATTTGCCAAGAAAAAAAAATAAACCAACCCAAAAAGAAGG ACCTTTCCCTGAACCAAAGAAAAGAAAACCAATCTCGTACGGCATGCAAG CTTGGCGTAAACAAGGGCAAA Allele pk541 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK541_R Allele pk541 0 1 Tc1 Clone pRPA9 Clone pRPBE8 Clone pRPBG3 Clone pRPCF5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK541_R TACAACCCGCCTTCCCATGGAAGAACACGGGGGGGTAAGGGAAAAAAGGG GGAGGGTTTGCTGGCAAAAAAGGAAGAAGAGGGGAAGGAAGTTATCTCCC CGAGTTAAAATCATTTAGTATAAATT Allele pk542 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK542_R Allele pk542 0 1 Tc1 Clone pRPB17 Clone pRPCB5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK542_R TACCATCACACTAACGTTCCAAAAACCACCAAAAATAAACCACCTATAAA ACGACAAGACAGCGAGACGACAACGAACCTCGAAAGAACAGAAAAAAGAG ACAACAAAGAGACAACGAACCTCGAACCAACGTGAACGCTGAGGGAAG Allele pk543 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK543_R Allele pk543 0 1 Tc1 Clone pRPB20 Clone pRPB5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK543_R ACCAACAAGGCAATACGTTGTGCGGAGAAGAAGTCCGGGGTTCAAAAGGA AGAAGGCCTGAATGGGAAAACCAAAGAAAAGAAAACCAATCCCCGAACGC AAGCAAACCTGGCCAAAAACAGGCACAGAGCTGTCCCCTGTGAAAAAGTG ATAC Allele pk544 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK544_R Allele pk544 0 1 Tc1 Clone pRPBC10 Clone pRPBC9 Clone pRPBD8 Clone pRPJA11 Clone pRPJB7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK544_R TACATAACTATAGCCGAATCAACAACCATGAGCAACAGGTTCGGGCGCAA AACTGCGAACGGGGCAAATCCTGGCTCTACCTGGCTCCCAGATC Allele pk545 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK545_R Allele pk545 0 1 Tc1 Clone pRPBC11 Clone pRPSB9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK545_R TATGAGCTGACGAGAGATTGATTGCTGAGATGTTGTTTGTTTAAAATAAA AAATTGAAGGGGGTTCAAAG Allele pk546 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK546_R Allele pk546 0 1 Tc1 Clone pRPBC4 Clone pRPCG9 Clone pRPJD9 Clone pRPJH9 Clone pRPWA8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK546_R TACCGAGTGTGCAGCCAGGGTGTGTATGAGGCCGCAATGAACAGGTAAAT GGCCGCCCGATC Allele pk547 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK547_R Allele pk547 0 1 Tc1 Clone pRPBC6 Clone pRPBD12 Clone pRPCA3 Clone pRPJB5 Clone pRPJF6 Clone pRPTE5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK547_R TAGTAAAAAAAAAAAACCAGTACTGACCCCAAAAGTGCCAGGATACGGGC GGGGCCTATTCACAATTAATTCGCGATC Allele pk548 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK548_R Allele pk548 0 1 Tc1 Clone pRPBD11 Clone pRPBF10 Clone pRPBH2 Clone pRPJC1 Clone pRPJH1 Clone pRPWB2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK548_R TATGTTCACTGATTTTCTTCAAGTTTTGAACTACAGTGACGTTTTTATTG ACTAAAGGATC Allele pk549 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK549_R Allele pk549 0 1 Tc1 Clone pRPBE3 Clone pRPVG6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK549_R TATGTGCACTTCCCTATTTCAAAGGCAATCACAGTTATGGCCCCAGACAA AAACACACTCACAGCGCACACTCAACCCCCAAAAACCGCAACTTAACGGA AAAACCCAACA Allele pk5124 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5124_L Allele pk5124 1 0 Tc1 Clone pRP10F5 Clone pRP11E12 Clone pRP7G11 Clone pRP8B11 Clone pRP9F6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5124_L TACATTGAAATGGGAAAATTGCAGGATTGTACGTGGATTGTCATGCAGAC TGTCTATAATAAAATAAGAAGAGAAAGAGTTGCTCCCCCAGAATAGGTGA TAGGCAGGTACCTCGGCAAAAACAAACATATTGAAAACATACCATATCTG ACGTGAAAGTGATC Allele pk550 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK550_R Allele pk550 0 1 Tc1 Clone pRPBF2 Clone pRPCA11 Clone pRPIE2 Clone pRPJA1 Clone pRPJA10 Clone pRPJD10 Clone pRPJE5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK550_R TATGACGATTGAACTTCTTGAACAACTGGCATCTCTTAACTTAACAAGTA CTAGATC Allele pk551 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK551_R Allele pk551 0 1 Tc1 Clone pRPBG1 Clone pRPCF6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK551_R TAAAAAAGGAACGCACACATTAAAATGTAAAATGTTTTTTTTGAAAAATA ATGCGCTGATATGTGTAAAAAACTCCGGCAATTTCCGAAAAAGAAAGATC Allele pk552 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK552_R Allele pk552 0 1 Tc1 Clone pRPBG6 Clone pRPIB4 Clone pRPIE1 Clone pRPJB3 Clone pRPSH6 Clone pRPUE4 Clone pRPVE4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK552_R TATATGATTATGACAGAAGGAGGGTGTTTGTTCGGCGATC Allele pk553 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK553_R Allele pk553 0 1 Tc1 Clone pRPBH10 Clone pRPJA2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK553_R TATAAAGCGCTATTCCGTATGTCTCTGACGCAAAAAAGAACACAAAAACA CACAGCGCGAAAAAATATTAGAAAAAATTTAGACGCCACATATGAAGAAC ACACACCCCACAGAGA Allele pk554 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK554_R Allele pk554 0 1 Tc1 Clone pRPBH6 Clone pRPTC3 Clone pRPUE12 Clone pRPVC11 Clone pRPWE11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK554_R TATGTGAGTTTTCAAATCAAGTTGGGGTATCTCGGAAAAAACTGTTGTAG GACTCACTTGTGAATGAAATGTCATCTTGGACCATATGGACAATATCCAC TTTGATGGAATGACTGACAAGCCTCTGTCTTGTACTTTGGATGTCGAGGA AC Allele pk555 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK555_R Allele pk555 0 1 Tc1 Clone pRPCA5 Clone pRPIA2 Clone pRPIC6 Clone pRPIE10 Clone pRPIH3 Clone pRPJC3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK555_R TAAAACGGTTGTCGGAGAAGAAGTCGGTGTTTCAGATGGAGGAGTGCTTG AGTGTGAGATC Allele pk556 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK556_R Allele pk556 0 1 Tc1 Clone pRPCA7 Clone pRPCG3 Clone pRPCG8 Clone pRPJB11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK556_R TATATGTATATGTAATATCAAATTCACTGAACCATATGAACCTGTGGGAA TTTTGCCTAGTAGAAAATATTAACTCACCTCAAAAGTATGTACTTTTCCT TGATC Allele pk557 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK557_R Allele pk557 0 1 Tc1 Clone pRPCB1 Clone pRPIH11 Clone pRPJA4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK557_R TATTGACTGGGACAACCTGACAGAACTATGTTATGAAAATGATC Allele pk558 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK558_R Allele pk558 0 1 Tc1 Clone pRPCB10 Clone pRPTD2 Clone pRPTE11 Clone pRPTE3 Clone pRPUF9 Clone pRPVE10 Clone pRPWC12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK558_R TATGAGTAATCTATTAAGCATTTTTGGTAGATCA Allele pk5125 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5125_L Allele pk5125 1 0 Tc1 Clone pRP10F8 Clone pRP11B1 Clone pRP11E10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5125_L TACATGTTGAAGAGACTGAGATGTTAAAGGGAAAAGAAGAAGAAGCTCGT TGTCGCTGTCGTCGTCTTCGAAGCCGTAGCACATCGAAATTGAATAAAAG GGGAAAGAAGTGGACACAAGAGACGCAGAAGAATGAGAAGAAGCCTGGAA TACTGCTTCTACTGCTGATTGTGACAACTCGAGACGACGAGATCGATC Allele pk559 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK559_R Allele pk559 0 1 Tc1 Clone pRPCC5 Clone pRPCF11 Clone pRPIF3 Clone pRPJF7 Clone pRPJH12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK559_R TATCAACCTAGATGACGTGGAATTAAGCCAGATATCAAGGTTTCGGCCTT CATAAACACATTAGGCTTTGATC Allele pk560 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK560_R Allele pk560 0 1 Tc1 Clone pRPCF1 Clone pRPIC2 Clone pRPID6 Clone pRPJB12 Clone pRPJH10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK560_R TATCTTGGTTTAAAGGCGATTTGTTTTTTTAGCTTGAAATCGATC Allele pk561 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK561_R Allele pk561 0 1 Tc1 Clone pRPCF10 Clone pRPSH2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK561_R TACCTTATTAAATCCTATTACAACTCTGTAACAACGTTTCACACAGCTCA TAGAGTTGCAGACATTTCACCTGAACACCAAATTTTAATTTTCGATC Allele pk562 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK562_R Allele pk562 0 1 Tc1 Clone pRPCF2 Clone pRPIE7 Clone pRPSB5 Clone pRPVF12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK562_R TATTTGGATTCGAACCCAATGAGTACCCTCTACACATACATATTTTGGCT AACAATATTTATAGTGGTTTTTAAAGTTGTAAGTTGTTCTTTAATCTTGA GCACGTCAAAAA Allele pk563 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK563_R Allele pk563 0 1 Tc1 Clone pRPCF7 Clone pRPSG11 Clone pRPUG10 Clone pRPWG5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK563_R TATAAGTCCACCGAAAGCTACTCCCGAGAAGAGTAGCGATTTTTCAGTAC TTCGCTCGAACCAATGGGTTTCTGAAATTTCTTACATTACAAAAAAATTG AAGATCGGAAATTTGCAAACCTGTGGAATTATGGAACATATGGAA Allele pk564 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK564_R Allele pk564 0 1 Tc1 Clone pRPCG10 Clone pRPCH3 Clone pRPIB10 Clone pRPVA10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK564_R TATGTTCTACAAAATTTTGAAAAACTGCATTGTCCCCGGGTCTAAAAAAA CCATTTTGTAAACACCACAAGTTTTTTAAAAA Allele pk565 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK565_R Allele pk565 0 1 Tc1 Clone pRPCG2 Clone pRPCH12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK565_R TATGTGAAACCTGAACCAATGGGGTCTAGGTAAACTTTAAAAAAAAAAAA CAACAAAAGCGGGCTACAACATAGCAGCAAGAGGGGGCTAAAAAATGATC Allele pk566 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK566_R Allele pk566 0 1 Tc1 Clone pRPEA1 Clone pRPIA10 Clone pRPJE3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK566_R TATGTACAAAATGTCAAGGAA Allele pk567 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK567_R Allele pk567 0 1 Tc1 Clone pRPIA7 Clone pRPIG1 Clone pRPJH4 Clone pRPTB3 Clone pRPTE4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK567_R TAGTGAGTTGCCCAATACTGTGGGAACGGTAAATTTGTGGATC Allele pk568 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK568_R Allele pk568 0 1 Tc1 Clone pRPIB2 Clone pRPJH3 Clone pRPJH7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK568_R TACATATTCCAGCTCCCTTTAAAAAACACCATTTTTAAAATCCCAAA Allele pk5126 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5126_L Allele pk5126 1 0 Tc1 Clone pRP10F9 Clone pRP10H9 Clone pRP7C2 Clone pRP8B6 Clone pRP8D3 Clone pRP8E2 Clone pRP8F9 Clone pRP9A10 Clone pRP9B3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5126_L TATTAGAAACTGGGACATTTTTGATGATAAAAGGTAAACCACTTCGTATT TTTCCCGAAAGTATAAATTAAACTTTTTAGGAACTCAGACAGAGTTATTT CAAAAAATTGTTATTTTCTAGATC Allele pk569 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK569_R Allele pk569 0 1 Tc1 Clone pRPIB9 Clone pRPID3 Clone pRPJD6 Clone pRPJE4 Clone pRPJE9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK569_R TAGCTACGGTCGAGAAGACTCCGTTTAGTACATTGTTGGCCAGATC Allele pk570 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK570_R Allele pk570 0 1 Tc1 Clone pRPIC10 Clone pRPSE9 Clone pRPUG9 Clone pRPVD4 Clone pRPWB1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK570_R TATCTATAAATCATTAATTACAGGATCGAAAAACACGATACATCTGGACT TGCAACGAGCCGATT Allele pk571 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK571_R Allele pk571 0 1 Tc1 Clone pRPID12 Clone pRPJH11 Clone pRPSG6 Clone pRPUA10 Clone pRPUG5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK571_R TATATGTGACGTGCACATCGCAGATCTTa Allele pk572 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK572_R Allele pk572 0 1 Tc1 Clone pRPID7 Clone pRPJF5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK572_R TATTTTACGGGGAAATAACCAATGAATCCAAACCCCTGGGTTTGGAAGTT GAAAAACCGGGAAAACAAAAGAAAACCAACC Allele pk573 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK573_R Allele pk573 0 1 Tc1 Clone pRPIF6 Clone pRPJE6 Clone pRPJG8 Clone pRPSD5 Clone pRPWC8 Clone pRPWD12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK573_R TATGTTTTTTTATACTTTCAATTTGCAGAGACGTGAGATCTG Allele pk574 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK574_R Allele pk574 0 1 Tc1 Clone pRPJA6 Clone pRPVG7 Clone pRPWH6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK574_R TACGTGCGGAACTTGATGAGCCATAGCTTTTTTCCCGTTAACCTTGCGAA TTGTATTTTCGGAATCCCAAATTTCGTCTGGAATTTTTTTTAAAGATTCA TAAAGTCTCTCGCAACCGATTCCTACCAACTGATC Allele pk575 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK575_R Allele pk575 0 1 Tc1 Clone pRPJA9 Clone pRPJE1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK575_R TAAAAACATGCTGCACATACACTTGCAAATATACTAAACGAACGGGGGGG AGAAAAAAAAAACCAAAAAAAAAAAAAAGAATCTGAAGAAGAAC Allele pk576 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK576_R Allele pk576 0 1 Tc1 Clone pRPJD12 Clone pRPWD6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK576_R TATGTTAACAATTGTATTTTTACATTTATCCGTGACGAGTAAGAAAAAAA AATGAAGCAACTTGGCAAAAAGTGGCTAAAACATATTTAGTCCTCCTGAC TAATGACTCAAAAAGCTGTGCTCGCCACAATGAAAAACCCTTTGG Allele pk577 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK577_R Allele pk577 0 1 Tc1 Clone pRPJD4 Clone pRPSB10 Clone pRPVE8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK577_R TAGGTCGCAAGGTCGCAGGTCGCTAGGTCGCAGGTCGCAAGGTCGCAGGT CGCTAGGTCGCAGGTCGCAATGCAACATACCCTCTAGGTCGCAGGTCGAC CAAGGCCAACTAAAACACCCCCAATAGAGACAACAACACGTAT Allele pk578 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK578_R Allele pk578 0 1 Tc1 Clone pRPJD7 Clone pRPJH2 Clone pRPVH5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK578_R TACGTTGCATAACCGTGTTCAACTGATCGCTGGGCATATGAAGAAGTTCT GATAGAAGATC Allele pk5127 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5127_L Allele pk5127 1 0 Tc1 Clone pRP10G4 Clone pRP7D6 Clone pRP8A11 Clone pRP9E3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5127_L TATATCCAAAATGTTTATAAACCATACCTCTGTTCTTAAAATTTTCTGAC GGAGCCAGCTCAAATAATACACTCTGATTCTCCTTTTTCTTCCGGAAATT GTTGCGAGAATATTTTGTCCCTCGAGAACCGTCATCTGATC Allele pk579 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK579_R Allele pk579 0 1 Tc1 Clone pRPJE2 Clone pRPUH7 Clone pRPWF12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK579_R TAGATCAACACACGATAATGTCTTCGCTCTAGAAGATC Allele pk580 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK580_R Allele pk580 0 1 Tc1 Clone pRPJH6 Clone pRPVF9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK580_R TACAAGAGTTACACAAAAGTGAAAAAAAAAAGAAAAGAGATACACAAAAA GTGCACAACACTCCACAAAAGGACAACACCTCTCGAGAAAAAAGAGCA Allele pk581 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK581_R Allele pk581 0 1 Tc1 Clone pRPSA12 Clone pRPSB6 Clone pRPSC7 Clone pRPSD9 Clone pRPSF5 Clone pRPSH12 Clone pRPTA12 Clone pRPTD8 Clone pRPUD3 Clone pRPUD5 Clone pRPVD12 Clone pRPVF8 Clone pRPVG9 Clone pRPWC1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK581_R TATATTCCCATCGCTAGGGACTTTTTCGAAGGGTTTGCTGGTTAGTTTTC CACACGTTTCACCAAAAATTTATAAATTCTTTGAAACAGTAGGAAATTTA ATATTAAAAAAAC Allele pk582 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK582_R Allele pk582 0 1 Tc1 Clone pRPSA2 Clone pRPSA6 Clone pRPVC12 Clone pRPVD3 Clone pRPWA6 Clone pRPWB6 Clone pRPWE2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK582_R TAGCTCTGTTAAAACAGGAAACAAATTGAAAAGAGAGGGTGATGGCGACG GGAGAAACGAAAAAAAAGAGACCGCTGGATTATCATTGATTTCCAAAAAT AAAGCTTAACGGTTGGTCAAAATATAT Allele pk583 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK583_R Allele pk583 0 1 Tc1 Clone pRPSA8 Clone pRPWA2 Clone pRPWC10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK583_R TACGTGTTTTGGAGCAGAGATTGGTTCAGCTCTACAATTGATTTTATTGC GTAGGCAGGTAGGCAGGCAGGCACAAGAAAGGCGTTTATGCCTACCATTG AAAAATGTTCAACTTACGATTCATCCCAAAAATGTTAGGAGTC Allele pk584 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK584_R Allele pk584 0 1 Tc1 Clone pRPSA9 Clone pRPSG4 Clone pRPTD3 Clone pRPTE2 Clone pRPUH2 Clone pRPVB1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK584_R TACCTTTTCACAAGATTGTGGCCACCAAAATGATGATATTCGGTGAACAG TCAGTGAAGCAGCCGACAGAAATTGTATATGCAAAAACCAC Allele pk585 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK585_R Allele pk585 0 1 Tc1 Clone pRPSB1 Clone pRPTF6 Clone pRPUC3 Clone pRPUE11 Clone pRPVF11 Clone pRPWB5 Clone pRPWB8 Clone pRPWD1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK585_R TAGAATTTCAAAGGTTTATTATTGATGTCGAAATGATAATACAAGAAACT ACTATTCA Allele pk586 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK586_R Allele pk586 0 1 Tc1 Clone pRPSB11 Clone pRPTC11 Clone pRPTD6 Clone pRPVE1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK586_R TATATGAATACAGCAAAAAAAAATACACAGCAATATTTTTTTCAGTTAAA AAAAAGTACTCAACAAGTTTCAAACCGCTTAAATATATTTAAAACTAATG CACCTACCCACAAACTCTAAATATGTCGTTTTTTTAATCCTTTTAGCA Allele pk587 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK587_R Allele pk587 0 1 Tc1 Clone pRPSB12 Clone pRPVB12 Clone pRPWE6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK587_R TATGTGTCTGAAAATTGGTGCCATCAAACAGTTATAACACGTTATACTGG TAAGTCG Allele pk588 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK588_R Allele pk588 0 1 Tc1 Clone pRPSB3 Clone pRPTC8 Clone pRPTF5 Clone pRPUB5 Clone pRPUC12 Clone pRPUD2 Clone pRPUF5 Clone pRPVB2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK588_R TAGATCTGATTTGACTGCAGAGGAAATAGTTACAAAAAAGGGAAAATCAA AGAAAAAATAAGCTTTTCTGTGTGACCCTGGAATAACATAAACG Allele pk5128 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5128_L Allele pk5128 1 0 Tc1 Clone pRP10A4 Clone pRP10E7 Clone pRP10F6 Clone pRP10G3 Clone pRP11D8 Clone pRP7B6 Clone pRP7C5 Clone pRP7E12 Clone pRP7G2 Clone pRP7G7 Clone pRP8A4 Clone pRP8B1 Clone pRP8C3 Clone pRP8D9 Clone pRP8F2 Clone pRP8F5 Clone pRP8G4 Clone pRP8H10 Clone pRP8H7 Clone pRP9C3 Clone pRP9F10 Clone pRP9F7 Clone pRP9G3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5128_L TATATGACGGCAGGAAAAATACCTGGATTGCAAAGCATAATAGCTTTGAA TAAAAGATATTCAATTTTGTCGACTTTATGATTTAGGAAAGTGATC Allele pk5129 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5129_L Allele pk5129 1 0 Tc1 Clone pRP10G5 Clone pRP7D1 Clone pRP8B4 Clone pRP8E10 Clone pRP8G11 Clone pRP8H12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5129_L TACATGGATAATGAGTTCACGTTACAGATC Allele pk589 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK589_R Allele pk589 0 1 Tc1 Clone pRPSB4 Clone pRPSH8 Clone pRPTC9 Clone pRPVB6 Clone pRPWE9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK589_R TATCAGAAAATTCTAATATGCTCAAATGCTTTGTATAACGGATTTGATAA AACAAGTAAAAAATATAATTCTGATTCTAGTGAAAAATGGAAGTTTATTA AAGCTCACTACTTTGTTACAAAGCCTACTAATACAAATAATACAGA Allele pk590 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK590_R Allele pk590 0 1 Tc1 Clone pRPSB8 Clone pRPTB8 Clone pRPUE7 Clone pRPVE12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK590_R TATATCAAAAAAACAAAAAAAAAAAAAAAAACACAAAAAAAAAAAAAAAA CAAAAATTTAACAGATTTAAACCCAATTTTTCAACCCCCCACCTTTGCTT GCCCGAAAAATAAAATTTCCCTTCCAGTTATTTCAAAATTCATTTTTTGA AATTAAA Allele pk591 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK591_R Allele pk591 0 1 Tc1 Clone pRPSC11 Clone pRPTG2 Clone pRPVE9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK591_R TATAACAGAGGTGCTCAGCCCTTCTGCCTGAGAGGTGTGTAAAGTTTTGG CCCATCTGACAGCTAGAAACACATAAAACGTGTCGATAATCTATGCACCC CCACTCAAAACTTTTGGACCTCCACCCCTTTGAAAATATGTTGCCATC Allele pk592 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK592_R Allele pk592 0 1 Tc1 Clone pRPSC12 Clone pRPUA5 Clone pRPWE1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK592_R TATGACTGAACCACGGGGCACAAATGTGTCATTGAATGGTCATATTTGAT AGAAAATAACGCTTAAGTTGGAAAGATTAGAAGAATATGCAGTGATTTTG TTCTATTAGATACAACAATTCAATTTTATTCAAGTTA Allele pk593 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK593_R Allele pk593 0 1 Tc1 Clone pRPSC4 Clone pRPSD8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK593_R TAGCTTCGCGCTACCATCGGCCAGCCCATTGAATGAATGATTCAATGAGT TGGTACTATAGATGCACTCGGTAAAAGAAAAAAGACGTGTACATTTGATC CCTTCTGACACCTAAAGTG Allele pk594 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK594_R Allele pk594 0 1 Tc1 Clone pRPSC5 Clone pRPSE5 Clone pRPSF3 Clone pRPTA10 Clone pRPUC1 Clone pRPVA9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK594_R TATGTGCATTGGTCGTTTACATTCTTTTGCATGAATGC Allele pk595 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK595_R Allele pk595 0 1 Tc1 Clone pRPSC6 Clone pRPWE8 Clone pRPWF6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK595_R TATATGTATTTGTCCGTGTGGAGTACAAGTTGTGCGGCGGGGGTGATTGT CAATGGAGCGCGAAAAATTCAAAGAGGAAGGCTAGAAGCCCGTGTATATA TCTGATA Allele pk596 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK596_R Allele pk596 0 1 Tc1 Clone pRPSC9 Clone pRPVG11 Clone pRPWH9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK596_R TACTTATATCCAAGATATACTACTGTAAAATTGGCAACAGATATATTAAT TTGCATTTATCAAGTTCACCAGTTCTTGAGTTGCCACTTTAATTTTTGAA ATTCCAAAAAAC Allele pk597 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK597_R Allele pk597 0 1 Tc1 Clone pRPSD7 Clone pRPVE11 Clone pRPWD5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK597_R TATTCACTGGTTGTTTCTAAAAGAGATAACTCACTGAAATCATCACTTTC GCAAAGAATGTTCTGCTTGTTACTTTGCTCGTCCTTAGTTCCTGCAG Allele pk598 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK598_R Allele pk598 0 1 Tc1 Clone pRPSE4 Clone pRPSF8 Clone pRPVB7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK598_R TACGTTTTTTTTGTTTTTAATCGTTC Allele pk5130 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5130_L Allele pk5130 1 0 Tc1 Clone pRP10H1 Clone pRP11A4 Clone pRP11C10 Clone pRP11C11 Clone pRP7C3 Clone pRP7E6 Clone pRP8E12 Clone pRP9D8 Clone pRP9E10 Clone pRP9H9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5130_L TATGTATCAAATGAACACATCTTTAAAACTTGGAACCGTGTGTGACTGAG ATC Allele pk599 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK599_R Allele pk599 0 1 Tc1 Clone pRPSE6 Clone pRPTE6 Clone pRPVH2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK599_R TAGTCCAAAATGTTTAAATTTAAAAATTTTTTTAAAATAAAAAATTTTTT AAACCCCTTTACAAAAAAGCCAACTGCCTTGGAAAAAAAATTAAAAACCC AAAAAAATTTAAACCCCCACGGGGCCAAAATAAAAGA Allele pk600 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK600_R Allele pk600 0 1 Tc1 Clone pRPSE8 Clone pRPWA1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK600_R TATGTGGGTATGTGTGGTTGTGGTGGTTCGATAGAAAAATGGAAAGTGGT GGAGTAGGGGGCCACATTGGAGACAAGAATCGAATAATAAAAGCGATAAA AGTGAGTAAGTTGGTGGTGGCAAAATGAATGTGGAGAAGAGAGAAA Allele pk601 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK601_R Allele pk601 0 1 Tc1 Clone pRPSF11 Clone pRPVG2 Clone pRPWB3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK601_R TAGGTCAGCTTTTGAAACAAAAAGAGCAGAAGAAGAA Allele pk602 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK602_R Allele pk602 0 1 Tc1 Clone pRPSF12 Clone pRPUB4 Clone pRPWA9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK602_R TATGTGTTCCGGTTCAGCCCGCAAAAAGTGTTTAGTGGCGTTCTCCTGAC TAGAACATATATTTATTTACAACACGTTTTGCTCACTCTCAGCCTCTTCA CCCAGATATTCCAGACTCGTGCTAATTGCCGGTCTCACCGTGTGCTC Allele pk603 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK603_R Allele pk603 0 1 Tc1 Clone pRPSF7 Clone pRPUF11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK603_R TACGGGAAAAAACCGGCCCAGGCAAAAAACAAATTCCGGTCCCCAATGGG AAAAAAAAAAACAACGAAGAAAAAACGGGGCCAACCAAACCCCCCTAAAA AAAAACCCCAATTAATCAAAACAAAAACAAAAAAACAAAAGGAAATAAGG Allele pk604 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK604_R Allele pk604 0 1 Tc1 Clone pRPSF9 Clone pRPUA6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK604_R TACTTCTTTAACAAGGCCAAGGGAAGATTTGAAAAAAATTTTTCCAACAA AAAATAACTTTTAAAACTTTCCAAAATTTCCAAATTTCAAAACCTTTAAA GGAACCCCCCCAAAATCCCCTTTTCAAAAGTGAACCAATAACAAACCAAC Allele pk605 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK605_R Allele pk605 0 1 Tc1 Clone pRPSG5 Clone pRPTE12 Clone pRPVE2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK605_R TATGTCATTTATCAAAATTCCACAAACTTCCTTATCTCCTTTTGTTCTAT TTTAAACGGTGTTCTTTAAAAATCACGAGG Allele pk606 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK606_R Allele pk606 0 1 Tc1 Clone pRPSG7 Clone pRPVD2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK606_R TATATACGGTATTATGAAAATTCCAAAAATGCTTGTTTTTCCAGAAATGC TGTGGACGGCTCCAGAATTGCTCCGAGATTCGAATGCTCCACCAATGGGA ACCCAGAAGGGTGATATCTATTCATTTGCAATTATTTTGCAAGG Allele pk607 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK607_R Allele pk607 0 1 Tc1 Clone pRPSH1 Clone pRPTE10 Clone pRPUC6 Clone pRPUE3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK607_R TATATCTCCGCGGAGTTATATACGTTTGAGGGATTTTAGCT Allele pk608 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK608_R Allele pk608 0 1 Tc1 Clone pRPSH7 Clone pRPWE12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK608_R TATGTATTTTCTTGTGTCAATTTGTTTTTGAAGATT Allele pk5131 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Strain KR1787 Strain RW7000 Sequence PK5131_L Allele pk5131 1 0 Tc1 Clone pRP10H11 Clone pRP8B7 Clone pRP8G6 Clone pRPRA6 Clone pRPRC11 Clone pRPGH3 Clone pRPLF5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5131_L TAGCTGTCCATTTTTGAATAATCGAGCCCGAAAACGAGACAAGCGCTACA GTAGTCATTTAAAAAGTTACTGTAGTTTTCGCCACGAGATATTCTGCGCG TCAAATATGTTGCGCATTACGTAATCTCAGAATTTCGAGTTCCTGTAATA TCACATGATGTCAAAAAGCCTCATTTCGGCTTGATC Allele pk609 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK609_R Allele pk609 0 1 Tc1 Clone pRPSH9 Clone pRPVF6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK609_R TATGTAACGGAAAAACGGGAAAG Allele pk610 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK610_R Allele pk610 0 1 Tc1 Clone pRPTA2 Clone pRPWE3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK610_R TACGTGTCGCGCAGAAAGGGGAACCGGCATAGTTTCAAATTCAAAAAACC TTTCAAATGCAAAAAAAAATTTTTTTTTAAAAACAACCGGTGGAGAAAAC CAAAAACGTCAAAAAAAAACCCCAACCCCGGGAAGCCCGGCCT Allele pk611 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK611_R Allele pk611 0 1 Tc1 Clone pRPTA3 Clone pRPTE1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK611_R TATATTGAAAAACGTAAATAGCAATTATCTCTTTAAAACGTGAAAAGTCA ACAAGATTTTTTTCTTCAAAAAATCATATTTTCATTCACAATCCAAAACT CGGGCCTAACAGATTCGACTTAACAATGAAT Allele pk612 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK612_R Allele pk612 0 1 Tc1 Clone pRPTA8 Clone pRPUG11 Clone pRPVA7 Clone pRPWC5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK612_R TATAAAACCAAAAAACATTTCCAAGTCAACACAAAGTTCTGCCAGATCAT TGGAATATGTCCCGTTGACTGAATTGCACCTGCCTAGACTAATGATTAGG ATTTTGATCTTATTTGAAAGTGCTGC Allele pk613 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK613_R Allele pk613 0 1 Tc1 Clone pRPTB2 Clone pRPUC2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK613_R TAGAACTTTAGCCATTCAATCACAATATGAAAGTTTTTAGAATTTTCTGA TACTACGATAATTGGTCATTTTTGCACCAACTTTAATATACAAAAGGTTC TAAATTTTAATAATTTAGCTTTT Allele pk614 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK614_R Allele pk614 0 1 Tc1 Clone pRPTB4 Clone pRPUH12 Clone pRPVA8 Clone pRPWA11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK614_R TATATCTTAGAGCGAAATTTTATATATTTTGAATTGT Allele pk615 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK615_R Allele pk615 0 1 Tc1 Clone pRPTB6 Clone pRPVC5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK615_R CATTACGAGATGAGAACGCACATTTTTTATACAAAAACGAAAAAAACGAA AACAAGAAAAAAACCCTTGGAAAAAAGAAAAGAAAAAACAAAACCAAAAC AAACCCCAAGGGAACGCCTGAAAAAACCGAAAAAAACCAAAAAAAAA Allele pk616 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK616_R Allele pk616 0 1 Tc1 Clone pRPTC10 Clone pRPVB3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK616_R TATTTATTTACACTCAAAAATCAAATCAAAAATTCCCCGAAAAATAATTC AAAATTTAAAAACAATCCTGAAAAATTGAAAAAAAAAAGGAACAAAGGAA AACACAAAAAAAAAGACAACACACACCCCGCACACACAACACAGCACA Allele pk617 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK617_R Allele pk617 0 1 Tc1 Clone pRPTC4 Clone pRPUG7 Clone pRPVB8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK617_R TACATCTTTCGTAAAAACCTTGCACAAGTGCGAGGTCAAGCTAATGGGTC TGAAGTCGGTTGGATTGTTAGCGTTAGTGATTTTTCCAAGAGGTATTACA ATGGATTTGGTCCAAGCGTGCGGGACTTGCCCTCTCAT Allele pk5132 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5132_L Allele pk5132 1 0 Tc1 Clone pRP10H7 Clone pRP11B7 Clone pRP11F5 Clone pRP11G8 Clone pRP7B4 Clone pRP7G8 Clone pRP9B6 Clone pRP9D6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5132_L TACGTGAAAAAAGAGTGAAGGAATTGGCGGGATGTCAGTTTGGATGTACA AATAGAACTCCTGAAGCATAAGAAACAGAAGAATCGACCGATGATC Allele pk618 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK618_R Allele pk618 0 1 Tc1 Clone pRPTD1 Clone pRPVC4 Clone pRPWE7 Clone pRPWF8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK618_R TATCTCAAAAATTCTTGAAACTCTAAAAATAAAAC Allele pk619 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK619_R Allele pk619 0 1 Tc1 Clone pRPTF12 Clone pRPUE2 Clone pRPVH9 Clone pRPWF4 Clone pRPWG3 Clone pRPWH1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK619_R TAGTTTGATGTACTTCTTCCTATTTCATACCACGATGAAGGATTTCGAGA GTCTCCTTGAGAATGTTTATCATA Allele pk620 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK620_R Allele pk620 0 1 Tc1 Clone pRPTF2 Clone pRPVC6 Clone pRPWB4 Clone pRPWF11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK620_R TACATATGCATATGGCTTTATTATGGTa Allele pk621 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK621_R Allele pk621 0 1 Tc1 Clone pRPTF3 Clone pRPTG3 Clone pRPUC4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK621_R TAAATGACCTACTTTCCTTTCAGCTTTTCC Allele pk622 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK622_R Allele pk622 0 1 Tc1 Clone pRPTF7 Clone pRPUA4 Clone pRPWA5 Clone pRPWB12 Clone pRPWC7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK622_R TATGTCCTTGGATAATGGAGGATACACCAAGATCTGTGAGTATTCCACG Allele pk623 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK623_R Allele pk623 0 1 Tc1 Clone pRPTG11 Clone pRPVB10 Clone pRPWD8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK623_R TATCATTTTAAGTTAGAGAAATAATAGTTTGAATTTTATATTCCAAAACT CGTG Allele pk624 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK624_R Allele pk624 0 1 Tc1 Clone pRPTG8 Clone pRPTG9 Clone pRPVC10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK624_R TATGTTAGTACTTTTTTCTTCCGAATAAGGCAAAAATTGAAAATTCTAAG AATCTCGGAACGGAACGAGAATTTTCTAACATTTAAATATTT Allele pk625 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK625_R Allele pk625 0 1 Tc1 Clone pRPUA9 Clone pRPUF12 Clone pRPVC9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK625_R TATATGTATCAGGTAAGAGATAATTTATTGGCAATTTTCAACAAATAAAA ATTTAGAAAGAACACCCAACGGAATGCACATTATCCGCCAGCGTTCACTA CAAAAGACTG Allele pk626 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK626_R Allele pk626 0 1 Tc1 Clone pRPUB12 Clone pRPVG1 Clone pRPWC11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK626_R TAAATGAACAGAACATTTATGAAAAATGA Allele pk627 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK627_R Allele pk627 0 1 Tc1 Clone pRPUB6 Clone pRPVE6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK627_R TAGATAGGGCGCTTGTAAGAACAATGGCCAAAAAAAAAAATAATAAAAGT TCCGGTTCCTTCAAAAAGTAAGGGAATTCCAAAAAAACAACAAAATAAAA AATGGGAAAAAAAGCCTAAACGCAAAAAAGTAACGCAAACAAGTCAAACA AGGAATAAAATTTTGAAATTCCCAACCCGTTTTGGAAAAAAAAAAAAAAA GCCGAATTCCCCGGTAAAAAAAAAA Allele pk5133 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5133_L Allele pk5133 1 0 Tc1 Clone pRP11A2 Clone pRP8F1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5133_L TACATCAAACCATGTCGGATGTGGATC Allele pk628 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK628_R Allele pk628 0 1 Tc1 Clone pRPUB8 Clone pRPUF1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK628_R TACTTGATAGCGAAAAAGACGGTGACTAAACTGGGCAACTACAGGTTTTT GATGATGCATATATCCTTATTTGAGCTTGGGTTTTCCGTCCTT Allele pk629 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK629_R Allele pk629 0 1 Tc1 Clone pRPUD4 Clone pRPVD10 Clone pRPVF2 Clone pRPWF7 Clone pRPWH2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK629_R TATATGCGGCAATTTTAAGATTTCAAAACCTTTGTAAAT Allele pk630 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK630_R Allele pk630 0 1 Tc1 Clone pRPUE1 Clone pRPWA4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK630_R TAGATAACCTGAATTAAGAATAAATGGGAAGAAAAAAAAAGGGAAAGTGA AGAAAAAAAACCTTTTTGGTTAAAAATTCAAAAAAAAAAAAAATAAAATT GGTTAACAAAAACCGCCAAAAAAAACCAAAATGAAAACAAAACAAAATTT AAAC Allele pk631 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK631_R Allele pk631 0 1 Tc1 Clone pRPVA11 Clone pRPVC3 Clone pRPVD11 Clone pRPWG12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK631_R TACGTCGCAATCACAAAAATTTGACAGACAACTGACAAGTAGCTTGTGAA GACTGCAAATTTGAACCAGTTGACCCACTGAAAATTGTATTTTTTATATT TGGGAGTCTGTCAGGGCCTACTTAAAGCTAGAAAACTCACAGGTATCCC Allele pk632 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK632_R Allele pk632 0 1 Tc1 Clone pRPVB9 Clone pRPWG9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK632_R TATAGTAATGATGATGAGCATCCGTTGGATGGTCCTCACACGATTCTGCA CGCTGTTCAGTGCCCGAAAAAGTTTATTGCGACGGTAATCTGATTTTTCA AATTTCGAAAACAAGCTTCTAAATTTAGGTCGCCCCAACGGAAGTAGC Allele pk633 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK633_R Allele pk633 0 1 Tc1 Clone pRPVD1 Clone pRPVF4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK633_R TATTGCTAGAAAAGTATTGCGTTCAATCAAGAAAACACAAAAAATATACA CTTTTGAGACACAAAAATCTCAAAAGAAAACGTGAAAATGATACGCGAAA AAGATAAAAAAAAACAGAGCTACACCCCCTTTTCTAAAAAAAAAAAACAC Allele pk634 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK634_R Allele pk634 0 1 Tc1 Clone pRPVE3 Clone pRPWD11 Clone pRPWF9 Clone pRPWH8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK634_R TACGTGAATCAAGACGAAATGAGACACTCTGACACCACGTGAAAAATCAA AAAATTTGAAATATTTGCATATTATTAAAATTAGTTTTTTTTTCTAAATT CTATTTATTTTCCCC Allele pk635 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK635_R Allele pk635 0 1 Tc1 Clone pRPVF5 Clone pRPVG3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK635_R TATACCATAACTGGGTGTAACCGAAAAAAACCCAATTTAACAAAAAAGGG GTTAAAAAAAACAAACCCAATTGAAAACTCCCCCGCCTTCC Allele pk636 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK636_R Allele pk636 0 1 Tc1 Clone pRPVH12 Clone pRPWG8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK636_R TATATATAGTTAATGATATTTATCCGAGGTGTTTTCAATTTTTAAATGGT TCCCAACAAGGTTTTAAAAGAGGTTCAACAAAAAGA Allele pk5134 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5134_L Allele pk5134 1 0 Tc1 Clone pRP11A7 Clone pRP11C3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5134_L TAGGGCCAAAAGGCTGTATAAAAAAAACAATGCAATTTATCCGGCAGTTG ATC Allele pk5135 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5135_L Allele pk5135 1 0 Tc1 Clone pRP1E6 Clone pRPZG9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5135_L TATATGCCATCATTGTTCAACTTTGGCAGCTCATATCTTGATTATCCGTT GGTTTAAGCCAAAAACAATAAACAAAAAAAAAATTAAAAAAATAACCTGA AAA Allele pk5136 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5136_L Allele pk5136 1 0 Tc1 Clone pRPGG8 Clone pRPKA1 Clone pRPLC5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5136_L TATATATAAAAAATCTCTTCCAGGCCCTAATCACTGTCAAACACCAAACG TCCGTCTGTCCATAGTTTGTAGTCTATGTAGTCTTTGTAGTGTGCAAAGT TATG Allele pk637 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK637_R Allele pk637 0 1 Tc1 Clone pRPIA4 Clone pRPID5 Clone pRPIH2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK637_R TAGTTCAATATCAGTCCCGGACTTCGAATGGAGACGTATGCCATTTAAAA ACTTAAGGTTAACCAAAAA Allele pk5137 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5137_L Allele pk5137 1 0 Tc1 Clone pRP11A8 Clone pRP11D3 Clone pRP11F10 Clone pRP8F8 Clone pRP9C7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5137_L TAATTGGTGCATATGAAATTGCCGGGTCATCTGATC Allele pk5138 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5138_L Allele pk5138 1 0 Tc1 Clone pRPKF4 Clone pRPLF9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5138_L TATATATAAAAAAAACACAGCGCCTCTCCACAGAGTGTAGACTATATAGA CTCTGTAGACTCTGACACCACACACAAAAACACAGAGAGAGGTGGGCGCG GCCCCTCACACCCGCGGGGAGACACACAGCGGGGAGACACACCTCGGGGA GACACACAGC Allele pk5139 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5139_L Allele pk5139 1 0 Tc1 Clone pRPYD3 Clone pRPZH7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5139_L TAGTTTTTTGAAAAAAAAATGAATTTTAAAAGAAAAAAACAAGAAAAAAC CAAAAAAAAGAAAAAAAGGAAAAAACACAACACTCTAAAAACG Allele pk5140 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5140_L Allele pk5140 1 0 Tc1 Clone pRP11B10 Clone pRP7E3 Clone pRP7F5 Clone pRP9B4 Clone pRP9G12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5140_L TATGTTCTTCAATGTTAATAACTTTAAAAGTCAATTCACGAGCAAACTTT AATCATGTCTAGAACGCCGCAGCATCTTGCTTTTTAGTCTGAGTTAAACA TAGATGCGTACGTGCGCGGATGGATTAACAGGTAACAGGATGGATTATTA AACAGAAGATGATC Allele pk5141 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5141_L Allele pk5141 1 0 Tc1 Clone pRP11B11 Clone pRP11F3 Clone pRP7C11 Clone pRP8B9 Clone pRP9E4 Clone pRP9G4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5141_L TATGTCAAATGCATTCTCAATACAAAGTACCTAAAAAAAAATGTTTCTTG ATTTTGAAATGGAAAAATTTCGCCTACTAGTAGCAACCATGTGCACATTG ATC Allele pk5142 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5142_L Allele pk5142 1 0 Tc1 Clone pRP11C12 Clone pRP8C11 Clone pRP8G9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5142_L TACGTGCATCCATGACCGGACCGACCTGTGGCATCAGCGTGTCAGATTGC ATGTGCGACTCGATATTCCCTCGCCAGGAGCAGATGTAAACATAAACAAC TGCTTTTCTCGACGAACTACAGTATTCCTCCTTTCATCTATATCCCATAC TGCCACAGATTCACACATACACAACGTATGTTCCTGACTGCATGGCGATG ATTTGTTGTGATGTATCCAATGTGGCTATATGAG Allele pk5143 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5143_L Allele pk5143 1 0 Tc1 Clone pRP10A6 Clone pRP11C6 Clone pRP7B1 Clone pRP7E1 Clone pRP7H4 Clone pRP7H6 Clone pRP8A12 Clone pRP8A8 Clone pRP8D7 Clone pRP8E7 Clone pRP9E11 Clone pRP9G8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5143_L TAAATAGGACTGAAACCAAAGAAGTTTTTAAATTTTCAGCTTACCGTGTT TCTCAATTTTCAAAATAGTCTTTTTTGTGTCTGAACGGGCTGATC Allele pk5144 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5144_L Allele pk5144 1 0 Tc1 Clone pRP11D10 Clone pRP7D11 Clone pRP7H9 Clone pRP8C2 Clone pRP8D5 Clone pRP9G6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5144_L TATCCGATTGCCACGGGCGCTCCCCAGAGCCGATTATTATTTGTCCTCCA AGAATTTTGACACCTTTTCGTCGTCGTTTTCACACGGTGCTTTTCACTTT ATACTTGCAATACTAGACGTGTTGACACAGTTTTCGAGTGGTGGAAAAGG ATC Allele pk5145 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Strain KR1787 Strain RW7000 Sequence PK5145_L Allele pk5145 1 0 Tc1 Clone pRP11D4 Clone pRPRC1 Clone pRPYE3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5145_L TACCTGGAGAAAAGAAGCGAGGTGGTTTGATTGACGGCATCAAGAACAAC TGAAATAAAATGGAATATAATTGGGAATAAAAATTCCGAATAGGGTACGT ACTGTATTTTTAATACGTTACCATACTTTCTTCATGCT Allele pk5146 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5146_L Allele pk5146 1 0 Tc1 Clone pRP11D6 Clone pRP11F1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5146_L TATATTACCGGAAACAACGAACC Allele pk5147 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5147_L Allele pk5147 1 0 Tc1 Clone pRP11D7 Clone pRP11F12 Clone pRP8F10 Clone pRP8H5 Clone pRP9C2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5147_L TACATACACTTCTAACATAAATACGAAATCACAAAAGAATCTAATCAAAT AAATAAAAAGTTCGACATAAGAGCAGATACCATCCGCTTTTATACAAAAG TTTCTTCCCGACAATGGCTCAAATAAGACTGAAAGATC Allele pk5148 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5148_L Allele pk5148 1 0 Tc1 Clone pRP11E3 Clone pRP7A3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5148_L TATATCCGCCGCCGCCCCGGAAATAAGGAACGCCCTTTCCCTAAGGGCAA AAAAAAAAAATGAAGAAAAAAAAAAAAACGGGTTTGGTCCCCCCTTTCAA TTAAAAAAAAACAAAAAAAAAGAAAGCCAAAACAAAAAAAAAAAATTGAA TTTTAAAAGTCCGGGAAGAACGGAAAAACGAGGGAACGA Allele pk5149 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5149_L Allele pk5149 1 0 Tc1 Clone pRP11F4 Clone pRP8C6 Clone pRP8G3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5149_L TATATGGACGGGGCTTGATATTCCAATTTTTTCGACCTTGGCATTTGGTA GCAATAATCTATTATCCCTGAACTATAAGCTACAAACTTGGGTTTTATAT TGGCAAGGGTTATTTTCCGGCAAGTCGGCAAATCGCCAGAATTAAAATTT CCGGCAAATCGGCAAACCGGCAAAATTTCGATC Allele pk5150 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5150_L Allele pk5150 1 0 Tc1 Clone pRP7C9 Clone pRP8C10 Clone pRP9A3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5150_L TAGGTAAGCAATTCAAAATCAATAAAAAAAAAAAAAATCAAAAAAAAAAC AAACCCCCCCCTCCTTCCCCGAAAAAAAACGTAAGGAAAC Allele pk5151 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5151_L Allele pk5151 1 0 Tc1 Clone pRP7F1 Clone pRP7F3 Clone pRP9D9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5151_L TACATATTACTTTATTGAATTATTAATACCTTAGATC Allele pk5152 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5152_L Allele pk5152 1 0 Tc1 Clone pRP7H10 Clone pRP9E9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5152_L TAACAGAAACAAAATATAAAAAAAAAAAAAAAAAAACTGAAAACAGCAAA AAATAACACCCGTCCAAAACTAAAAAAGCACACAAAAAAATAATAAAAAA CAACAAATAAAACAAAATAATAGAAAAAAAAAAACAAA Allele pk5153 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5153_L Allele pk5153 1 0 Tc1 Clone pRP7H2 Clone pRP9A5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5153_L TACTTCAAAATTTTGAATTTTCAAAAACACAAAACAGACAACAAAGAGAA GACAGAAAAGAGAAGCAATCAGTTCGTCCGGCGAAGAAAGAACGAACGCA GGCACGGAAGGCAACCAAAAGAAATAAACAAACACGTATGTAGATAGAAA ACAAATGTATATAAAAAAAACAAG Allele pk5154 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5154_L Allele pk5154 1 0 Tc1 Clone pRP10A7 Clone pRP10C7 Clone pRP10F2 Clone pRP11B4 Clone pRP11F9 Clone pRP7B8 Clone pRP7F4 Clone pRP9E7 Clone pRP9F11 Clone pRP9H6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5154_L TATGTGGGCATGTTGCAGTCTTCTTTGATTACTGGAGGAATTTTCCTCAT CTATGTGCTCCGATC Allele pk5155 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5155_L Allele pk5155 1 0 Tc1 Clone pRP7H5 Clone pRP8A7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5155_L TATTGAAAATAGAACAAGTGCACAAGCACAAGCAACACCAATACACATTT AAAATGAAAAAAATAAAACCCAGA Allele pk5156 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5156_L Allele pk5156 1 0 Tc1 Clone pRP8C12 Clone pRP8F6 Clone pRP9H12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5156_L TAATGTAAACCTTTTTTTTAAAAAAAAAAAAATTAACCAAACTGTTCTGA GACATTTGATTATTCTTTTTTGATTTTAATGACATATGAAATATGAGAAT AATGTTCAAAACCATGCAGACAACTGGTACGATC Allele pk5157 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5157_L Allele pk5157 1 0 Tc1 Clone pRP8C5 Clone pRP8E5 Clone pRP9A4 Clone pRP9C6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5157_L TATGTGTCACTTGAAACTTGAAGTGACTTCCAGTCTGATTATCAATTGAA ACCTTTGCAGTGCGTCTCGTGAGTTGTGGTGGAGTTGGATC Allele pk5158 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5158_L Allele pk5158 1 0 Tc1 Clone pRP8C7 Clone pRP8H11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5158_L TAGTAACTCCACCGCTGAGA Allele pk5159 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Strain RW7000 Sequence PK5159_L Allele pk5159 1 0 Tc1 Clone pRP9B5 Clone pRPYB5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5159_L TATAATATAAAAAAGAGAACACAACACTCGCACAAAAACGTAAAATCCAA AAAGGAAAAC Allele pk638 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK638_R Allele pk638 0 1 Tc1 Clone pRP2A1 Clone pRP2A4 Clone pRP2B1 Clone pRP2B12 Clone pRP3G11 Clone pRP3H6 Clone pRP4D7 Clone pRP4F2 Clone pRP4H7 Clone pRP5D10 Clone pRP6C10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK638_R TAGGCCTAGGCTAGATAACTTCAAAATTAAGTGAACTTTAAATTTTCTGC ATTTTTTGGTGAGAGTTAAAAGGTTGCAATAGGATTTCAAAAATTTTGCA AAAATTCCTAAAGCCTGGTACTAGCCAACTTCCTTCAAATTTAGGATC Allele pk639 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK639_R Allele pk639 0 1 Tc1 Clone pRP2A10 Clone pRP3D1 Clone pRP3H4 Clone pRP5G5 Clone pRP6A7 Clone pRP6B2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK639_R TACGACCAAAACGCGTAATCATCAAGAAACGGATC Allele pk640 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK640_R Allele pk640 0 1 Tc1 Clone pRP2A12 Clone pRP2E2 Clone pRP4G3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK640_R TATATATTTAAACGTTACTTGAATTTCAGCTGTGCCCGGATTAGATTCCT GGAACCAAGAAATCATCGAAAAGGAACGAAATCAATACGTTAAAGCTCTT CTAAATTATTGTCTCCTTCAACATGGAAAACTTCAAGGCCCAACAAGATT CGCAAC Allele pk641 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK641_R Allele pk641 0 1 Tc1 Clone pRP2A2 Clone pRP2C8 Clone pRP5A9 Clone pRP6H10 Clone pRP6H5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK641_R TATATGTTTTGGATTTTAATCAGAAACCAGAAAATCAATTACCCGAAAAC Allele pk642 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK642_R Allele pk642 0 1 Tc1 Clone pRP2A3 Clone pRP2E8 Clone pRP3F8 Clone pRP4E1 Clone pRP4E11 Clone pRP4F7 Clone pRP4F9 Clone pRP5F5 Clone pRP6B4 Clone pRP6D7 Clone pRP6F12 Clone pRP6F5 Clone pRP6G12 Clone pRP6G5 Clone pRP6H7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK642_R TAGGTTTTCAAAATTAGTGGGTGAGAGAAGCAGACAACGAGGCGAGCGTG CTGTCTGCGTCTCCCTTTCCTCTTCACTCTATCGAGTACCACGTGGTGTC AAAGTCCCTCATTTCGGCTTGATC Allele pk5160 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5160_L Allele pk5160 1 0 Tc1 Clone pRP10A8 Clone pRP11B8 Clone pRP7A12 Clone pRP7B5 Clone pRP7C8 Clone pRP7F6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5160_L TAGATTGTATTGAATCTTATTGACTGAAATACTATTTATTTGCAGTCAAA CGGATC Allele pk643 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK643_R Allele pk643 0 1 Tc1 Clone pRP2A5 Clone pRP3H5 Clone pRP4B7 Clone pRP4G4 Clone pRP5G6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK643_R TATATACAAGTTAATCAAAAAGCAATTCTAAACTCTCAAATGTCATTTAC CAAAATGTGAGGGTAGGCATCAAGAGCATCTGGGCTTCCGTAATCAATGA GCTTGGAGAAACTTTCAGCCGCAAAAACATCAACCCAGGTTTCGCGATC Allele pk644 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK644_R Allele pk644 0 1 Tc1 Clone pRP2A6 Clone pRP3H8 Clone pRP4B5 Clone pRP4B6 Clone pRP4E3 Clone pRP4E7 Clone pRP4F8 Clone pRP5B11 Clone pRP5E4 Clone pRP5G11 Clone pRP6A11 Clone pRP6A3 Clone pRP6C4 Clone pRP6H8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK644_R TAGTTGGAACAATTTTAAGTTTTTTTCATTGTCTGGTGATC Allele pk645 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK645_R Allele pk645 0 1 Tc1 Clone pRP2A7 Clone pRP2E3 Clone pRP2G1 Clone pRP4C12 Clone pRP4D8 Clone pRP4H10 Clone pRP5F7 Clone pRP6B7 Clone pRP6G10 Clone pRP6G9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK645_R TATGTATGTGCAAATGCTAGGAATGAGGGAGAGAACCCGTGTATCTGATT TGAGTAAGCAAGTATGATC Allele pk646 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK646_R Allele pk646 0 1 Tc1 Clone pRP2A8 Clone pRP2D11 Clone pRP2H10 Clone pRP3D12 Clone pRP3D2 Clone pRP4A1 Clone pRP4D10 Clone pRP4G8 Clone pRP5B6 Clone pRP5B7 Clone pRP6C9 Clone pRP6F11 Clone pRP6F3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK646_R TATTAGACACATACCTCTATCCAAAGTTACACCAATCGTCTGTGAAATCA GATTTCTGCTTGGATC Allele pk647 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK647_R Allele pk647 0 1 Tc1 Clone pRP2B10 Clone pRP2C11 Clone pRP2F9 Clone pRP3F3 Clone pRP3F7 Clone pRP3G4 Clone pRP5A4 Clone pRP5C11 Clone pRP5C12 Clone pRP5C5 Clone pRP5D4 Clone pRP5E9 Clone pRP5H2 Clone pRP5H9 Clone pRP6E7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK647_R TAATACACTAGTTAGTGGGGAATAACGGAATGTAGGACAATGATGTGCAG AATTAGATC Allele pk648 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK648_R Allele pk648 0 1 Tc1 Clone pRP2B11 Clone pRP2D10 Clone pRP3A10 Clone pRP3A11 Clone pRP3A4 Clone pRP4H4 Clone pRP4H8 Clone pRP6A1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK648_R TACGTCAAGTTTACGGCACATTTACGAGAATTTCATAAGCGTTAATTTTA GATTCTGAAACTACTGTTTCACATGGGATTTCTACTTTTACCACATTACA AACACCTCCACCTCGTTTCCCTTTAGCACGATC Allele pk649 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK649_R Allele pk649 0 1 Tc1 Clone pRP2B2 Clone pRP2E10 Clone pRP2G11 Clone pRP2G2 Clone pRP3C1 Clone pRP4B2 Clone pRP4F12 Clone pRP4H12 Clone pRP5G7 Clone pRP6A9 Clone pRP6B5 Clone pRP6C7 Clone pRP6H9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK649_R TAGGTCGATGTGTCTCTACCAGTCATACTACAAACCACATTTCACTGCGG TAAAGAAGTTTTGTGTTTACCATGTCTTAATTGTGATC Allele pk650 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK650_R Allele pk650 0 1 Tc1 Clone pRP2B3 Clone pRP2B5 Clone pRP2C9 Clone pRP3F4 Clone pRP4B4 Clone pRP4B8 Clone pRP4C3 Clone pRP4E4 Clone pRP4F6 Clone pRP4G7 Clone pRP5F2 Clone pRP6A5 Clone pRP6C8 Clone pRP6D6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK650_R TACATCACTTGCTAAGTAACTTTACTTTTAAATCTCGATC Allele pk651 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK651_R Allele pk651 0 1 Tc1 Clone pRP2B4 Clone pRP2B8 Clone pRP2G9 Clone pRP3H7 Clone pRP4A6 Clone pRP4F10 Clone pRP4G1 Clone pRP5A11 Clone pRP5A3 Clone pRP5D11 Clone pRP5H8 Clone pRP6F9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK651_R TACATAGGTCGTAGGTAGCATTGCAACCTAGGTAGAATTGCGACCTGCGA CCTAGCGATC Allele pk652 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK652_R Allele pk652 0 1 Tc1 Clone pRP2B6 Clone pRP2D12 Clone pRP2G8 Clone pRP3B6 Clone pRP3E7 Clone pRP3F9 Clone pRP6E4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK652_R TAAAGTAAGTGGATGGATACACAATTTATACACGGATGCATAATAATTTC CAGTCAATGACATATTTCCGTGTCCTTCTTCAAACGATTACTCAACATTA TGGTTCTTCAACTAAAAGTTGGTCACCAATTCTGGTTAAGTTACTTCCAA AACTAATGG Allele pk5161 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5161_L Allele pk5161 1 0 Tc1 Clone pRP10A9 Clone pRP10C4 Clone pRP7F12 Clone pRP7G9 Clone pRP7H1 Clone pRP8A2 Clone pRP8G1 Clone pRP8G7 Clone pRP9D5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5161_L TATAAGAACATTAACAAACAAATTATGGAACTTTTGAAACTTTTGAACAA TTTGTTAGTTTACAACTTTTTGATATCTTCTATTCCTGCCGAGATC Allele pk653 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Strain KR1787 Strain RW7000 Sequence PK653_R Allele pk653 0 1 Tc1 Clone pRP2B7 Clone pRP3H2 Clone pRP4B10 Clone pRP4E12 Clone pRP4H2 Clone pRP4H3 Clone pRP5D5 Clone pRP5G10 Clone pRP6A8 Clone pRP6D5 Clone pRP6F4 Clone pRPMD1 Clone pRPMF9 Clone pRPMH4 Clone pRPNA4 Clone pRPNC8 Clone pRPNF9 Clone pRPNH4 Clone pRPNH8 Clone pRPOF3 Clone pRPPA4 Clone pRPPF1 Clone pRPPF10 Clone pRPA7 Clone pRPUB9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK653_R TAGATATACTTTAGCTTTTCTTCAAGAAGATTTTTTTATGTGTACGGAAA AATTCTTAAATCAATTGGTCTTACCATTGTGTGTAAATGACCGAAATGAC CGGCATTTGGCAGGTCCCCATACTGATTGTGCCTTTCTTGTTGGCTTGAT ACGATC Allele pk654 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK654_R Allele pk654 0 1 Tc1 Clone pRP2B9 Clone pRP3H9 Clone pRP4A10 Clone pRP4G11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK654_R TACAGGGAAAAACGGAAAGCTTCAACAGAAAATAGATACCGTAACAGATC Allele pk655 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK655_R Allele pk655 0 1 Tc1 Clone pRP2C1 Clone pRP2C10 Clone pRP2C4 Clone pRP4G12 Clone pRP5D1 Clone pRP6D11 Clone pRP6F10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK655_R TACAGGTGCAAGTGCTCGGCAAGCACAAGAAAGAAGGCTTTTGATTCAAT CAATTGCACTGACCACGTTTATACTGAGCCACGAAATTGCGTCTTTTATT ACTGAGTTGTACATAGTAAGATAGTTCGGAATTATAAAAATAGATC Allele pk656 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK656_R Allele pk656 0 1 Tc1 Clone pRP2C12 Clone pRP2E4 Clone pRP3B2 Clone pRP4C7 Clone pRP4F11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK656_R TATGTGTAGAGCTCTCCTCCACTGGTCATACTCGATGACCAAATGGACAC GTGTGAGGGTCTCGACAACCTCGAATAGTTTTACAATGTTCGGATGGTTC ATCTCCTCCATTGCCTGAATTTCTCGACTCAGAAGCTTTTGGGCTTTGGC GTCCATTTTCGCCTTGTC Allele pk657 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK657_R Allele pk657 0 1 Tc1 Clone pRP2C2 Clone pRP2F4 Clone pRP2H7 Clone pRP3A8 Clone pRP3B3 Clone pRP3B9 Clone pRP3D3 Clone pRP3F5 Clone pRP4A7 Clone pRP4D6 Clone pRP4E10 Clone pRP5B9 Clone pRP5C9 Clone pRP5G3 Clone pRP6B1 Clone pRP6E6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK657_R TACATTTGACTTTGGAGCGCGATTGCATTCCGATTTAAACTCACGGGCAA CACAGTGCAGCCATCCAAGCGGAGACATAAGTGAGCTGATC Allele pk658 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK658_R Allele pk658 0 1 Tc1 Clone pRP2C3 Clone pRP4A5 Clone pRP4C8 Clone pRP5D9 Clone pRP5H5 Clone pRP6C1 Clone pRP6D9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK658_R TATATGGTGTGTGTTGCTTTTTGGTAGTGGTGGTAGGCGAGGATACTACT ACTTTCTACTCTTCCCCTCATCTAGCTTTTTTTTTGGAGAAAAAATGTCA AAAAAGTGAAAAACGGGTTGATTGTTTCGTATTTCAACTATTGCGAACAT TGTCAACGATC Allele pk659 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK659_R Allele pk659 0 1 Tc1 Clone pRP2C5 Clone pRP2D4 Clone pRP2G4 Clone pRP2H11 Clone pRP3H10 Clone pRP4A8 Clone pRP6E2 Clone pRP6F7 Clone pRP6H3 Clone pRP6H4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK659_R TATAACAGCGTGTAAATCGGAATAATACCTCCAGCCGGGTGGTTTCATCC CACTTTTTTGCCACGTTTTTTCATGCTTAAGGAAAGTTCGTGATGTCCTT GAGGAAGTGCGGGGGATAGTTCAGACTTTTAGCCTGAAGATAAGTTTTAA ATTATGGGATC Allele pk660 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK660_R Allele pk660 0 1 Tc1 Clone pRP2C6 Clone pRP3F6 Clone pRP3G1 Clone pRP3G7 Clone pRP4A2 Clone pRP5D6 Clone pRP5E8 Clone pRP6C11 Clone pRP6E5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK660_R TAGTGCCACAAAAATATTTTTATGGGGAAATTCAACGAGATGGTAATGTA ATGAATATGTGTTGTCCATATTAAATGCGCAAAGAGAATACACATCCATT TAGATTGTAAGTGTGCTCTATTGATAAAAATTATTGCCAAATTGAGTTTT CGCAATAAGAGCAGGCAAGAAAAAACGATC Allele pk661 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK661_R Allele pk661 0 1 Tc1 Clone pRP2D2 Clone pRP3B10 Clone pRP3E11 Clone pRP3G10 Clone pRP3G8 Clone pRP3G9 Clone pRP4D3 Clone pRP4D4 Clone pRP4D9 Clone pRP5A1 Clone pRP5D7 Clone pRP5E7 Clone pRP6B12 Clone pRP6E12 Clone pRP6H1 Clone pRP6H2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK661_R TATATCCTACTGATAGTCGTCACCCCATGAGAGACATATGTTATCATAAA TATATCTGTATTTTTATCATTCAATATTTCTCAATTGTTTGATC Allele pk662 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK662_R Allele pk662 0 1 Tc1 Clone pRP2D7 Clone pRP2G5 Clone pRP2G7 Clone pRP4A3 Clone pRP4C1 Clone pRP4E9 Clone pRP5E2 Clone pRP6A10 Clone pRP6B6 Clone pRP6D10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK662_R TAATATGCAGCTAGCAAATGCCGATATTGCTGAATGCTAAAATCTTCGGC AAACGCCCACCAGTTTTTCGAAGTTTTAGCTATTGTCAATCTTATATTTT GGAGTGTTTTCGTGAAAATTGTAGTCATATTTTCATTTATATGTAGTGAG ATC Allele pk5162 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5162_L Allele pk5162 1 0 Tc1 Clone pRP10B1 Clone pRP10D3 Clone pRP10G1 Clone pRP10H4 Clone pRP11B6 Clone pRP11F11 Clone pRP7C12 Clone pRP7F7 Clone pRP8E3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5162_L TACATCATCCCATCTCTTTCTCATGTACAACACGCGACAAAGGCAACCCT CAGGATGTCGGGAGAGATAAACACACTATTCCCATAGCACGGCCTCTCAT AAACTTACCTGGCTGGGGGCTATTTTGCGATC Allele pk663 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK663_R Allele pk663 0 1 Tc1 Clone pRP2E11 Clone pRP3H12 Clone pRP5D3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK663_R TAGTAGGTACATTGAAAATTAGAAACAAAAAAAAAATTTAGAAATATTAT GGGGGGGAGGAAGAAAAGAAGGAAAAAAGGAAACAAGAAGAAAAGAAAAA AATATATAAAAAAAAAAAAAAGAAACATGGGAGGAAAAAATGGGAGGAAA CATGGAAAATAAGG Allele pk664 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK664_R Allele pk664 0 1 Tc1 Clone pRP2E12 Clone pRP3B4 Clone pRP6D2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK664_R TAGTTTGTTTTAAAACCTTTCTTTAATAATAAAAATATTATTTACATCCC GTAATTTATATATGGATTCCTTTTACCTTTCTCTAAGTGAATTAAAGTTA AGAAAAAAAATCGAACGGTCAGTTTAATGTGTACTACCTCTTGTACGTCC AAGTGGATC Allele pk665 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK665_R Allele pk665 0 1 Tc1 Clone pRP2E5 Clone pRP3A6 Clone pRP3B1 Clone pRP3D9 Clone pRP5A10 Clone pRP5F3 Clone pRP5F6 Clone pRP5H7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK665_R TACATAAAAAGCGTTGGCAGTGGAGAAAAGCACGAGAAGAGTGGCGATC Allele pk666 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK666_R Allele pk666 0 1 Tc1 Clone pRP2F1 Clone pRP3C12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK666_R TACGTAACCAAAAAATAATAATAATTAGTCAACAACCAAAAAAATGATAA GAAGAAAAAAAAGAATATCCACCACGTACAACAACAAAAGAAGACAAAAA AAACATTTGGAGAAAAGGATAAAA Allele pk667 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK667_R Allele pk667 0 1 Tc1 Clone pRP2F11 Clone pRP4D12 Clone pRP5C2 Clone pRP5F12 Clone pRP6B10 Clone pRP6C3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK667_R TACGTGTTGCTAAAGTTACTCCTCCCTTAAACACTTAAAACAAAATCGTA GACCTCAAAAACTATATCCCCAACATCGTAATTTTCAGATATATGTACAT GGTCCTAATGACACTTTTACCATTTTTCTTCTTACTGTGTATCAATGCAA TTATTGTGAAAAGGCAGTCTAAGGCAAAA Allele pk668 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK668_R Allele pk668 0 1 Tc1 Clone pRP2F3 Clone pRP3A1 Clone pRP4F1 Clone pRP4G5 Clone pRP5F11 Clone pRP5G9 Clone pRP6F1 Clone pRP6G3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK668_R TAAAGGGATACTCTTACTATTAGAACAAGCTAGATTGATC Allele pk669 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK669_R Allele pk669 0 1 Tc1 Clone pRP2F8 Clone pRP6C6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK669_R TATAGGGTGGAAGCTTCAGAATCTGTTACGCATCATGTGCTCGTATTACA AGAGAGACTATTTCGTAAGCCTTAATTATTCGAAGCCAAAAACGAAAAAT TTAAATAAAAACAAAAACTTAAAAACTTTAAAAAAAAAAAGTTCCGTGCC AAAAAAAA Allele pk670 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK670_R Allele pk670 0 1 Tc1 Clone pRP2G10 Clone pRP5D12 Clone pRP6F2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK670_R TACATATGTACATAAAGAAAATAAAGACAATCCAAGAGCCAAACTAGTTT TTAAGGAAAGAAATAAGACGAAAAACGAGGAAAAGCCAAGAATTTGATTC CGATTTTAAAAGTCGACATCGACACCAAGAATGGCAAGGCCAGAAAGCAT CATAGGCACCCTTTTTTCTCACCCCGGTTTTTC Allele pk671 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK671_R Allele pk671 0 1 Tc1 Clone pRP2G6 Clone pRP3H3 Clone pRP5A6 Clone pRP5A7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK671_R TATGTGAATTAATTGCGATC Allele pk672 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK672_R Allele pk672 0 1 Tc1 Clone pRP2H12 Clone pRP3C9 Clone pRP3F1 Clone pRP4G10 Clone pRP5G4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK672_R TATATTTACACTTGTTTTTGAACCAACTAATTATGCATAAAATCAAACGA GGACACCCCCAGAGGGTTCATTTTGGGATC Allele pk5163 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5163_L Allele pk5163 1 0 Tc1 Clone pRP10B3 Clone pRP10D2 Clone pRP10H8 Clone pRP11C5 Clone pRP11E8 Clone pRP7D2 Clone pRP7D4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5163_L TACGTCATTTTTGTCATCTCTCTAAAAAAATTTATAGTTTTCAGCGGCGA GCAACAAAGTCCTACTAACCTGCTCGAACTTCTTATAGATC Allele pk673 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Strain KR1787 Strain RW7000 Sequence PK673_R Allele pk673 0 1 Tc1 Clone pRP2H3 Clone pRP3C5 Clone pRP4A4 Clone pRP5F8 Clone pRP6E3 Clone pRP6H11 Clone pRPMB1 Clone pRPMD4 Clone pRPMD5 Clone pRPMG9 Clone pRPMH2 Clone pRPNB4 Clone pRPNG12 Clone pRPNG2 Clone pRPOC3 Clone pRPOF1 Clone pRPPB1 Clone pRPPC1 Clone pRPPD7 Clone pRPPG12 Clone pRPJF8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK673_R TATGTATTAAAGTAATATGGAGTATTGTGAATTAGAAAACAATCATCTCC GTGGAACAGTTTGAACATAAATTCTTTTGCGTTTGGATAATAACGAATTT GAAGATC Allele pk674 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK674_R Allele pk674 0 1 Tc1 Clone pRP2H4 Clone pRP3E10 Clone pRP3E2 Clone pRP4D2 Clone pRP5E12 Clone pRP6A6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK674_R TACATACACGTCGCCAGCAACCGGCATTGCCAAAGTTTCTGCAACCGGCA GCTTCTGGTTGCGGAAACTTCGGAACTTCGGCAATTTGGCCCCTAATGTA AGAGCCCTGATGCCCATCGTGAACTCACTGATGCATTCAGGAATCTACAG TAATCATCAAGGGCGGAGTTGATC Allele pk675 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Strain KR1787 Strain RW7000 Sequence PK675_R Allele pk675 0 1 Tc1 Clone pRP2H8 Clone pRP3F10 Clone pRP3F12 Clone pRP3G12 Clone pRP4G6 Clone pRP5H3 Clone pRP6D4 Clone pRPMC9 Clone pRPME4 Clone pRPMF8 Clone pRPMG11 Clone pRPMH10 Clone pRPNA6 Clone pRPNH1 Clone pRPOB2 Clone pRPOF11 Clone pRPOG9 Clone pRPOH9 Clone pRPPB3 Clone pRPPB9 Clone pRPPD12 Clone pRPIF10 Clone pRPIF9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK675_R TATCTATTTTTCATAGTTTGTTGCGAACCCAGATTGTGATC Allele pk676 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK676_R Allele pk676 0 1 Tc1 Clone pRP2H9 Clone pRP3A5 Clone pRP4C9 Clone pRP4H11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK676_R TACGTGTGTGTTGGCAAGGAAGCGCTAGTCTAAAAAATTTTCAAAAAAAA ATATTTAAGAAAGAAAGGGTTTTTAAAAGGAAGTTGTGGGGGGGGAA Allele pk677 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK677_R Allele pk677 0 1 Tc1 Clone pRP3A2 Clone pRP3C10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK677_R TACATACATCGCTAAAAGTTATATACAACGAAAACCTACAGATC Allele pk678 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK678_R Allele pk678 0 1 Tc1 Clone pRP3A7 Clone pRP5F9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK678_R TATATGTTTTTCAAAATTTTGGAAAAAGTAAAAAAAGTTTTTAACAAATT TTAAAAAAATTTTTTTTTGAAAAATCCAAAGAATTTTTTGCCAAGGGTTT TGGGCAAAGAATTTTTTTTCCGCAACTTCAAAAACGCAAAAACTTGCCGC AACCAAAACCGGCCAACCAAAATTTGGGGAAGGAACC Allele pk679 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK679_R Allele pk679 0 1 Tc1 Clone pRP3A9 Clone pRP3C11 Clone pRP4B3 Clone pRP6D12 Clone pRP6G7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK679_R TAATGGCCTGGAGCTGTCTTACAAGTACATTGCCGGACTTCCATCGGGAA AACTTGATTTGGAAGAGTTAATTCAAGCTGTATACCACAATTGGATC Allele pk680 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Strain KR1787 Strain RW7000 Sequence PK680_R Allele pk680 0 1 Tc1 Clone pRP3B11 Clone pRP4B1 Clone pRP4C4 Clone pRP6A2 Clone pRP6E8 Clone pRPMC8 Clone pRPMD9 Clone pRPOA2 Clone pRPPA7 Clone pRPPH12 Clone pRPUF6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK680_R TACCTGCACATTAGAGATGCTTTCTTTTCTCTCGCACAAATGTTCTCATT TTCATATGACTGCAGAAGTTTTAATATCACATTATAAATTCAGTTGATAA TCAGAAAACGAAAACAAATCTAGTAGAATTCTTTTTGGCCAGCACTGTAC A Allele pk681 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK681_R Allele pk681 0 1 Tc1 Clone pRP3B12 Clone pRP3E12 Clone pRP4A12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK681_R TAATATACTCAAATAAAAAACAAAATAAATCAAAAAATAAAAAAATTATT CCCCAAAAACCAAAAAAAGGTCGCTCGATGGCAGGCCATCCAAAAAAAAA GTGAGTCCAAAAAAAACTACATCCATTTCAACCAAAAATTTTTTTCAACC TAAA Allele pk682 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK682_R Allele pk682 0 1 Tc1 Clone pRP3C4 Clone pRP3E5 Clone pRP3E6 Clone pRP3G3 Clone pRP3G5 Clone pRP4C11 Clone pRP6A4 Clone pRP6C12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK682_R TAATTACAAGCAGACTCCCACTTTACTTTTGTCACAGTCTGTCCATTTGA ATACTTTACTAAGTCACACGATTTCATCACCATATCACACACACAATCAC TAGAACACGTATACAAGTAGCCAAATACTGAAATTTCAGATC Allele pk5164 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5164_L Allele pk5164 1 0 Tc1 Clone pRP10F7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5164_L TACGTATTTTTGCAATATACTTAAGGAGGACATGTTACCCGGAGGCTAAAAATTTATAGG ACTAAAGGAAGCGTTAAATTAAGGTGGCTTGTCTTTTAAAAAACTGTGATTTTAACTTCC CGCATGTTTTAGTAACGTCAATATTTTACGAACTTTGAACTAAAAGTGCCACTTTTAGG Allele pk5165 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5165_L Allele pk5165 1 0 Tc1 Clone pRP10G10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5165_L TAGGTNTTCGAGGTAACCCTCCCTATTCAGTGAATCCATTTCTTAGGCTCCTAACGTGAA TGAATAATGCAACCGTTTTCTCGTCTTCTTTTNCCCATNTTTGGAGGTGTCGAAACTTTT TNTNTCTCACCGTTTTTTAATAATACATGAGACGCGGACAATGGCACTAATTTCGTTC Allele pk5166 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5166_L Allele pk5166 1 0 Tc1 Clone pRP10H5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5166_L TATGTTANNATGTTATCAANTCAAAGTNANTTCACGAGCANTTTANNCATGTCTAGANCG CCGCACATCTNGCTNTTTAGNCTGAGTTAAACATAGATGCGTACGTGCGCGGATGGNTTA ACANGTAACAGGNTGGNTTATTAAACAGANGATGATC Allele pk5167 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5167_L Allele pk5167 1 0 Tc1 Clone pRP11A3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5167_L TAGTTCCTTTAGAATCATAAACATTTATTGTGCTCCTTCTTGCACTTATCAAAATACTGT TAGACTAATTAGTAANATTGAAGACCTTGTGGAACATCAAGGCAAAGTTGTAGTTGTGAG AGATC Allele pk5168 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5168_L Allele pk5168 1 0 Tc1 Clone pRP11A5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5168_L TACATTTCCCATATCAGACAGTTGTAATTATCGCTATTGATAGTTGTTTTGAATTCTTCA TTCTTCTCCAAAAACAAGTAATTATGACTAATAGTAAAGTTCCAAAGNGAAAGAATGTGT TTGAATTTTTGATC Allele pk5169 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5169_L Allele pk5169 1 0 Tc1 Clone pRP11B9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5169_L TAGGGTNCCTAAGGCGAGCTCAGAGAGGACGGAAACCTCTCGTAGNCAAAAGGGCAAAAG CTTGCTTGATC Allele pk5170 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5170_L Allele pk5170 1 0 Tc1 Clone pRP11D5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5170_L TATNNGTTGCCTTACAGTACGTAAATAGTAGAAAAGAAACAAAAAACGGAATTGTGATC Allele pk5171 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5171_L Allele pk5171 1 0 Tc1 Clone pRP7A10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5171_L TATATAGCTCTCCTAAGAATTTCACCGACCCGCGAAATGTCGGCTGCTTACCAAGAAAAT GAGTATTCACCCTTTCAAAAAGCCCATCAAAAAGCGCGCTTGCAAAGNNCATACACACAC TACAGACAGAGGGGTTGCTAGTATAGAAGGAAGAAGTAGAAGAAGAAGAAGAAGCAATAT TT Allele pk5172 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5172_L Allele pk5172 1 0 Tc1 Clone pRP7A11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5172_L TATATGTATTACTAGGTTCATGCTTTATATGTACTTTTATTCCACGGGTTTTACCTTGAT TCCAGTCCTTGTAATTAGAATGATGATC Allele pk5173 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5173_L Allele pk5173 1 0 Tc1 Clone pRP7A6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5173_L TATGCCCGGTTAATTATGTATTTGTTTGATGCTTTTTTAGTCCCGCCACGGTTTTTTTCA TTTCGAAAAGTCGATC Allele pk5174 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5174_L Allele pk5174 1 0 Tc1 Clone pRP7B3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5174_L TATAGATACAATTACAAACAATTTATGGCCTTTTAGAACTTTTGAACATTTNTTCAGTTT ACAACGNGTNGATATCTTCTATTCCTNCCGTGATC Allele pk5175 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5175_L Allele pk5175 1 0 Tc1 Clone pRP7C7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5175_L TACATTGTGGTGTGCGTCAGAGCATGTATAACAGAACATGCCGAAGATGAATTGCAGTAT ATACATCTCAAGTGAACATGAACCGAGAGAAAGGGAGAGGGATGGGGGTTAATTACTGCA AAGACTTTTTTCTGCTTATCAATCACTAGGAGGGAGTAAACACCGAAATTGATC Allele pk5176 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5176_L Allele pk5176 1 0 Tc1 Clone pRP7E2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5176_L TATGAGGGCATTTTTTTCCATATCTCAATTTTCAGTGTTGACCTCGAAAGAATTCTTTTT GGCAAGCACTGTATGTTTGGAATTTGTTGCGAATAGATGTCGCGAGTTGGTAATGCATAC CCAATGATC Allele pk5177 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5177_L Allele pk5177 1 0 Tc1 Clone pRP7F2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5177_L TATTATGANAATAGTAAAGTTCCAAAGAGAAGATGTGTTTGAATTTTTGATC Allele pk5178 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5178_L Allele pk5178 1 0 Tc1 Clone pRP7G5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5178_L TAGTTCCAGGAGAGGACAGNGATTCNNTACGGCATGCTTTTTGGCCAGCACTGTACATTC TTGTCTCCGTAGAACGAATAGCACTTGCAGACAACCTTCATGCACCAGACATGGACGAGA ACTCCTGTGAAATGAATAAGAATGGCTGAAGCTGGATTCTCTCCATTCATATTCTGGT Allele pk5179 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5179_L Allele pk5179 1 0 Tc1 Clone pRP7H7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5179_L TAGGTATCACCAGACCATCGGAATTGAACTTTAACTGTTTTAAATTGATTTGTATCCGGA CAGGAAACATTTCTGATTTGATC Allele pk5180 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5180_L Allele pk5180 1 0 Tc1 Clone pRP8A1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5180_L TAGGCAATCGTGAGTCAGTAGTTTACAAACATGTGCAACGTCCTACATNCATTAGGTAAA AGTTCTAGANTTTTTTTGTNCATTTNNGAATNTGTNCTGAGATC Allele pk5181 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5181_L Allele pk5181 1 0 Tc1 Clone pRP8C4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5181_L TATCTGCTCTATTTTGCATGTTAAAAGATATAGAGTTTCTTGTTGGCTATTTCACCAAAA ACTAGGCAAATAATTCGTCAAATTTCAGATTTAAAAAATCATGTAGTTTTGAAAAGACAA TAATCGGAACTGTGTTAAAATGCATCAATGACAAGTTGATC Allele pk5182 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5182_L Allele pk5182 1 0 Tc1 Clone pRP8D10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5182_L TAGGTCTNNCATGTTGTATCATGACCTTGCAATTTATCCGGCATNNGATCCAAGGAGAGG ACAGCNATTCTCTACGGCATGCCTACGAGANTNNNCNNTNNTNCNTNGNTNTNNANNTNA NNTNCCATNCCTNNTTACCTNTTAATCCATNC Allele pk5183 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5183_L Allele pk5183 1 0 Tc1 Clone pRP8E6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5183_L TACATTTCCCATATCAGCATTGTATTATCGCTATTGATAGTTGTTTTGAATTCTTTTTGG CCAGCACTGTACATATTACTTTATTGAATTATTAATACCTTAGATC Allele pk5184 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5184_L Allele pk5184 1 0 Tc1 Clone pRP8G10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5184_L TAGTTGATAGACGTTGAAAATCTGAAAAAAAAAGTTAACTTTGCAGTATGTTTATACTTT TGTCTGCGTTTGTCATTGCAATTGCACTTTTTCTTCTATTTTATGATTACTCTGAACCTT CCGACATAAATCCTCAAGCTCATCTTGCAAATTCTACAACAAAAGATC Allele pk5185 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5185_L Allele pk5185 1 0 Tc1 Clone pRP8H9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5185_L TACATGACTACCNTAACTTTTCGCAAAGCTTTTAAGACTGGTAGAAGAGATTGTGAACTT TGAATCGACTGGTGAACATTTTGGAACTGCTCTTTCAGTGCGTTCATCAATTCATNCTCG TAGCTTACTTTGGCGACAAGCATATCTCGAAAAGTTTTCTCAGCAAGTAAAAGTTCCACG AATGAGTTTGCATTTTCAAATGAATCTTTCAATTTGTTAATAGTATCAACAATATTGGAA AAACTCAAATCCTNATCTNCTAGTATTTN Allele pk5186 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5186_L Allele pk5186 1 0 Tc1 Clone pRP9A1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5186_L TATGTAGACCGAGTAGGAAGTTTTAGATGTTAATGGAAAACAAAACATTGTTTCTCAATA TTGATC Allele pk5187 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5187_L Allele pk5187 1 0 Tc1 Clone pRP9C9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5187_L TAATTACCCAGGAGNGCACAATGAGGCGGACACTGAAAACCACCTCTGGCAATGAAGGTT GGGCTTCGAATGAGAGCAATAGTCCAAGTGGCTAAGAAGCAAGAAGGCATCGAGTCAGCT GAGTGTTCCGAGATGAATAAGGACGACGAGAACATTATCGATAAAGATGATC Allele pk5188 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5188_L Allele pk5188 1 0 Tc1 Clone pRP9E5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5188_L TCGNTTNTCNTGANGTTCTTGANAGAATCATNTTTATTTGCAGTCAAACGGATC Allele pk5189 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5189_L Allele pk5189 1 0 Tc1 Clone pRP9G5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5189_L TATCTGCAAAACTTCTTTTAAAAAAACACATGGAAAATACAATGTTTATTCAATAAAAAA AACTTTTCGGACAATCCAATTTCGTTGCATAACACAATNTTTTAGTTGGTTGATC Allele pk5190 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK5190_L Allele pk5190 1 0 Tc1 Clone pRP9H2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5190_L TATGTCTCTGAAGCGAAATGCCAAAGATC Allele pk683 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK683_R Allele pk683 0 1 Tc1 Clone pRP2A11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK683_R TATATGTCGTCATGCTGAACATATATGTCATCATGTGAAAAATTATACTTTTTATTTGGA TTTTCGAACAAAATACGAACTTACGAAATTGAATTGTTAGTTGAACATTTTTTGATC Allele pk684 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK684_R Allele pk684 0 1 Tc1 Clone pRP2A9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK684_R TATGATGNTTTGGATTTTAATTCAGAAACCAGAAATCCANTTNCCGCAGATC Allele pk685 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK685_R Allele pk685 0 1 Tc1 Clone pRP2D6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK685_R TACGACCAAAACGNNANCATCAAGAAACGGATC Allele pk686 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK686_R Allele pk686 0 1 Tc1 Clone pRP2D9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK686_R TAGATGCGTTTGTCCAATCACAGTTCGCTGGCCATTCCTGATAACATACCGTAACCCTNT CCGTNGACACAAAATGATC Allele pk687 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK687_R Allele pk687 0 1 Tc1 Clone pRP2F6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK687_R TATGGCGAAACACGGTCATCAGTTACATTTTTCGTGGGGAAAGACCCTCCAAAGATTGTT CCACAAACTATGATTTTCGCAGGGGGATTGANGAAACGANATATGCATGTNCAACACCAA NCACTCTANTATCATTCCNCTATACACCACGNTATCAT Allele pk688 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK688_R Allele pk688 0 1 Tc1 Clone pRP2H1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK688_R TATCTCGTATGTTGCATTGTGTGCCTTAGCCTGTCGGAATGCTCCAGATATGAAAATCAC CCCAGCTGGAGTCTATGCATTTATTCTGTAGTTAGAACCTATTTTNGATAAAACCTACCA CTGACACAGTCTAGAAAGTNGTNTTTNGCTACTCAATTACTNNAAAAAAATGATGTAAAA CATGTAAATNGAACAATAATGTNT Allele pk689 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK689_R Allele pk689 0 1 Tc1 Clone pRP2H5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK689_R TATTTCTGAACGCAAATTGCATAACTTCTCCATTGACGTCTTAGTCAGACTTAAACTGGC TCGGATACAATTAGGGAGTTTACACTTTTGCCTTCTTGTGGAACGATGGCTTAAGTTAAG CAGAAGCGTAATGAACGGGAAGAGAAAACGAGAGCTTTTTGAAAAATTAGATATTTAGGA ATGAGGAGCGGAACAGTTAAAAATTCAAACTGAAACCAATGTAGGAGATGTATGAAATCA AACTTTTTGAGACAGAGCTTATTAAAAN Allele pk690 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK690_R Allele pk690 0 1 Tc1 Clone pRP3C2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK690_R TAGATGGTGAANGTTGATACTATTCACGTTTGATACTATTGTTTACTTTGAATGTTATAA ACTCTAAGAGTGTCGTTTACAAACATTCAAGCAATGTTGCATTTTGCAAATGTATTTNGA ACCTCTTATCAAGCCAATGTGTCATTTTGATC Allele pk691 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK691_R Allele pk691 0 1 Tc1 Clone pRP3C8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK691_R TACATACACGTCGCCAGCAACCGGCAATTGCCAAAGGGTCTGCAACCGGCAGCTTCTGGT TGCGGAAACTTCGTAACTTCGGCAATTTGGCAGTCGCAGCAACCGGCAATTGCCAAAGTT TCTGCAACCGGCAGCTTCTGGTTGCGGAAACTTCGGAACT Allele pk692 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK692_R Allele pk692 0 1 Tc1 Clone pRP3D10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK692_R TACTTCTACGCACTCCTGNCCTCTCAGACATCGTCTTTGTTCATTTCGGTAGGGCTCGTT TATTTTGTTTTGCTTAGGTCAATTTCAAGATATTGCAACAAAGGATAACATAGGGGAGAA GGGAGAGATC Allele pk693 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK693_R Allele pk693 0 1 Tc1 Clone pRP3D11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK693_R TACATANTCNGCAAAACAACTATATGTTGAAAAAANACTTTCCNACATTTCAGAAAAATC CAGAAGACTGATTTGAAACCTTTCAGAAACAGAGCAATAACATTGCAATATGTTTTTAGT GGCCATCTTTCTTTAAAAAAAAACTAACTCTTGCAAAAACTGC Allele pk694 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK694_R Allele pk694 0 1 Tc1 Clone pRP3D4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK694_R TAGTCGTCACCCCATGAGAGACATATGTTATCATAAATNTATCTGTATTTTTATCATTCA ATATTTCTCAATTGTNTGATC Allele pk695 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK695_R Allele pk695 0 1 Tc1 Clone pRP3D7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK695_R TTTTTTTTGGTNGGTGTTAGGCTGAGANCTGTTACACATCAAGCTGAAACTTGATC Allele pk696 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK696_R Allele pk696 0 1 Tc1 Clone pRP4A9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK696_R TACGTTNANGTTGTTCTGATC Allele pk697 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK697_R Allele pk697 0 1 Tc1 Clone pRP4B9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK697_R TACGACCAAAACGCNNAAGCATGCAAGAAACGGATC Allele pk698 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK698_R Allele pk698 0 1 Tc1 Clone pRP4C5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK698_R TANTGCCACATGAAGAGCAAAAATNAAGAGACAGGGAAGGGTAAAACACGGGGAAAATGA ATAGATTTTTTTTGGAAGCGAAATTGAGCCTAAAATCGATC Allele pk699 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK699_R Allele pk699 0 1 Tc1 Clone pRP4D5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK699_R TAGCTNTTCAAGTTCATCGGCAAAACATGGTGCATCAACTGTTACATGATC Allele pk700 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK700_R Allele pk700 0 1 Tc1 Clone pRP4F3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK700_R TATTCANCACCNGACCNTCATCACCTCATGTATCCCTCTTCAACACTTGTGCCTCGCCCT CCTGATC Allele pk701 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK701_R Allele pk701 0 1 Tc1 Clone pRP4G2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK701_R TAGATTATTTAATTGAGTTTGCATTTTACTGAAGCATTTTCACAGTTCCTAGTTGCAGTT AGAGGATGTACTTCTTAAAACCGATAGTCGATAGCTCCGAATAACAAACTTCATCACATT CAATTCTACATTTTCAGGCACTACCAACTTCGATGGCTACCTCAAACATATAAGTGTCAT TGCTCACGTTGCCAATGGAATCACCCTGCAGGCTGGACTGATGAATGAAAAGATTCCGAT C Allele pk702 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK702_R Allele pk702 0 1 Tc1 Clone pRP4G9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK702_R TACACTCTATTAACACTAACGATC Allele pk703 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK703_R Allele pk703 0 1 Tc1 Clone pRP5A2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK703_R AATTTATAATGTGATATTAAAACTTCTGCATCATATGAAAATGAGAACATTTGTGCGAGA GAAAAGAAAGCATCTCTAATTGTGCAGGTACAGTGCTGGCCAAAAAGAATTCGAGCTCGG TACCCGGGGATC Allele pk704 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK704_R Allele pk704 0 1 Tc1 Clone pRP5A5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK704_R TAATTCACGGGGCCGAGATTTACAGCAGACGAGTCGAGCTTACAGACAGCAGATATATCA GGTTTCATCCTTTTACGTGGTTTAAAAAATTCAAAGAAAATTATTCACAGAACGCGATAA GTGCAATGCGGGTGTTGTTAGATGCTAGGAACAAATTAGGAATTGCATGGGAAGATC Allele pk705 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK705_R Allele pk705 0 1 Tc1 Clone pRP5B1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK705_R TAANGGNNACANTANCTTAGAACAAGCNAGNTTGATC Allele pk706 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK706_R Allele pk706 0 1 Tc1 Clone pRP5B12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK706_R TATGTGTATCACTCATAGGAGGCGGAATTCGAGCGTGTGAAAAAGTCATGAANTTGATGT CGCCTTACCGTATATTTTATTGCAGTAATCGGCAAGACACTCAGACTGCAATCGATC Allele pk707 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK707_R Allele pk707 0 1 Tc1 Clone pRP5B3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK707_R TATAAGTANNTGGAGTATGTGATTAGAAAACATCATCTCCGTGGACATNTNGAACATAAA TTCTTTTGCGTTTGGATAATAACGAATTTGAAGATC Allele pk708 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK708_R Allele pk708 0 1 Tc1 Clone pRP5B4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK708_R TACANNGGTNCNTNNNTNAGCATTGCAACCNNGGTCAGTAATTGCGAACCTGTGNACCTA GCGATC Allele pk709 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK709_R Allele pk709 0 1 Tc1 Clone pRP5C3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK709_R TATTTATTTCCTCCAAAGCTACTAATATTTATGATTGACGACTCAAATTCAGAGATGAAC ATTCAGAAAATGAGTTGAAAACGNCGAGAGAAAAAGAAGTGCCGTCAAAAATATTTGGTG GTCAATTACTCCATTACTTCTGCAATGCTTCTCGTGTCTGCCCATTTTTGATC Allele pk710 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK710_R Allele pk710 0 1 Tc1 Clone pRP5E10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK710_R TATTTGCATCANGCCAGAAATAACATTTATTTGGAAATATGAACAAGAAAATTCAACAAT TGCAATGCATCTTTCAAATGTGAAAATGACTACTTGGATGCCTCAAAGTGATTTATTAGG TAGGATC Allele pk711 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK711_R Allele pk711 0 1 Tc1 Clone pRP5E11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK711_R NTTNNGCAANGNANTTATNATGTGATATTNAAAACTTCTGCAGTGCCATATGAAAATGAG ANNATTTGTGCGAGAGAAAAGAAAGCATCTCTAATTGTGCAGGTACAGTGCTGGCCAAAA AGACTTCTTTTNNCNNACGNTTNTNGCCTCAANAGTTTGNCTCNCTCCCTTAAACACTTA AAACAAAATCGTAGACCTCAAAAACTATATCCCCAACATCGTAATTTTCAGNTATATGTA CATGGTCCTAATGACACTTTTACCATTTTTNTTCTTACTGTGTATCA Allele pk712 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK712_R Allele pk712 0 1 Tc1 Clone pRP5E3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK712_R TATAACAAAAGTTCATGAAAATACTATTTCTAAAATTAACAGAGATTTTTCGTTTATAGG GTGATTTTTCAGTTGATGGGTNTACGAATTCGGTAAACAACATCGACCAAAAATTGATC Allele pk713 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK713_R Allele pk713 0 1 Tc1 Clone pRP5E5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK713_R TACAACTGAATTTATNAATGTGATATTAAAACTTCTGCAGTCATATGAAAATGAGAANAT TTGTGCGAGAGAAAAGAAAGCATCTCTAATTGTGCAGGTACAGTGCTGGCCAAAAAGAAT TCTTTTNCCNACCTNANTNTTATTNCATAAGTTTNTTGCGAACCCAGATTGTGATC Allele pk714 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK714_R Allele pk714 0 1 Tc1 Clone pRP5F1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK714_R TAGNANNAGNNNTGNNTTATTCTAGGTACCTCCACAATACTTCAATCTCTGTTATTACAC CGAACTTTTTTGATAAATTCCCATCTATTCGAGAACTGTANTTTTAACATTATTTCAATT TGAACATTTTCCATTTTTCAGTGAGATTGATAATTCTGCTCATTTGGAGCACATCGATGG ATC Allele pk715 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK715_R Allele pk715 0 1 Tc1 Clone pRP5F4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK715_R TAGTGTNNANNACCATTCANANGACAAACCACATTTNCACNGCGGTNNAGCAGCTCTTGT GTTTACCATGTCTTAATTGTGATC Allele pk716 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK716_R Allele pk716 0 1 Tc1 Clone pRP5G1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK716_R TACGCAGCCAAGAAGAGGNTTTGATCAACATTGCANGACCACGTTTATACTGAGCCACGA AATTGCGTCTTTTATTACTGAGTTGTACATAGTAAGATAGTTCGGAATTATAAAAATAGA TC Allele pk717 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK717_R Allele pk717 0 1 Tc1 Clone pRP5H11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK717_R TTACACATCAAGCTGAAACTTGATC Allele pk718 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK718_R Allele pk718 0 1 Tc1 Clone pRP5H4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK718_R TATTTTTGGATGGTGTTAGGTGAGAATGTTACACATCAAGCTGAAACTTGATC Allele pk719 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK719_R Allele pk719 0 1 Tc1 Clone pRP6A12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK719_R TAGTGGGGATGAACGGATGTAGGACATGATGTGCAGATTAGATC Allele pk720 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK720_R Allele pk720 0 1 Tc1 Clone pRP6B8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK720_R TAATGAACTCGTGGATTTTGCTATGGATCTTCTTACGAGAACTTCCACTTCTCTGAAAAT TGAAATTTTGCACATTACTAAACGATGAGATC Allele pk721 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK721_R Allele pk721 0 1 Tc1 Clone pRP6C5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK721_R TAGTNCATGNGNCACNCATTNNCNTACGGCTGGNNGTAGNNTGTTGGANNGCNTGTGCCC ACATTTTAGGTGCCCAGTGTCGGTGGTTTGCTCTCAAATTCCAAAAGCAANAAGTTCCAG AAAAAAAAGCGANAAATAGGGAACTTTAAAAATGTTGAAACATCAAAATAGCAAACAAAC ACTCAAAATGTNTATACATACAGNGCTGGNCAAAAAGAATTCTTTTNGCNTCGTGTTNNN CCCCGNCCAGTAGGAATGTGATC Allele pk722 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK722_R Allele pk722 0 1 Tc1 Clone pRP6D1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK722_R TATTAGTTTGCCAGGTGTTTTCTTAGATGGTGGCGGGGTGGTTTTTGGAATTTTTCGGCT TTTTGACAGATTTTCACGAAATATCAATGAAAATTCCTCAAAAGCGAAAGTTTCGAATTA CAGTACTCGTCGTTAAAGGCACATGATACAAAAATTTGTCGTGTCGAGACCAGATACCGT ATTTTTTTGGGAAAAAATCGCAAATCTGAGTTATAAAAATTTTCGGCTATTCGACATGGT GCAAACGGCATGCCTGCAGGTCGACTCTAGAGGATC Allele pk723 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK723_R Allele pk723 0 1 Tc1 Clone pRP6D3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK723_R TACATTAATNAAATTACATTGNACATTGGNTNAACGATC Allele pk724 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK724_R Allele pk724 0 1 Tc1 Clone pRP6D8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK724_R TACATTCTGCTTTGCGTGACTAAAGGATTAATGGAGAAGATGCCGGTGCCATATCTGAGA AGTTTCGATGCTGTACAGTATTATCACAAACAGCTGCTCAACAATTTCTATCATCCAACG GAAAAAGAACTCGATGCAAAAGATGGTAAAGGTTTTAATGAAGAGGCGAAAGAGGCAAAG ATTTTATTGGATC Allele pk725 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK725_R Allele pk725 0 1 Tc1 Clone pRP6E10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK725_R TATATNTTTCAGGTGACCCTGCATGCCTTACCTATTACTTGCATTTGATTCAAATATCCG CGAATTCTTTTTGGCCAGCACTGTATGTATGTGCAAAATGCTAGGAATGAGGGAGAGAAC CCGTGTATCTGATTTGAGTAAGCAAGTATGATC Allele pk726 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK726_R Allele pk726 0 1 Tc1 Clone pRP6E9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK726_R TATGNAAATCATTTATTGATC Allele pk727 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK727_R Allele pk727 0 1 Tc1 Clone pRP6G1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK727_R TACGTCGGTAGTTTTTATCTTCAGAAACAAATGCATCCTAAACGGNAANTACGNAGGGAT NGGGTAAATANTTTATGTAAATATAATGNTTTAGCTGAAGCTTTTAAATGGAAATCTGAC TNGCAACTATATGGATC Allele pk728 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK728_R Allele pk728 0 1 Tc1 Clone pRP6G6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK728_R TATTATCCGCACACCCTGGTACCGACTCTAGCTGCACCGGCACCAAAGAAGCGCATCGGC ACCGACTCTAGCCGCGTCGGCCANTACACACGTATCATATNTTGGCTGGGCCGTTTCGCG AAAATCGGTGCCGATGCGCTGATGTCGGTGCCATATAAAATCAATTAGCTGAGAAAGA Allele pk729 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain CB4000 Sequence PK729_R Allele pk729 0 1 Tc1 Clone pRP6G8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK729_R TNCAGNTTTTCGTTTTTCGAAAANTTCANTGATGGCCTACATTTTCGAAAGTAGGTCAAA TATTTTGAATTATGGCTCAAAAAATCGGGCTCCGTCAGCCTAACTATGTGTCAAGTTTTG AAAAGATC Allele pk5191 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK5191_L Allele pk5191 1 0 Tc1 Clone pRPRA10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5191_L TACATTCCTTGGAGCTGAAATATATTNTTTTTCAAAATGATC Allele pk5192 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK5192_L Allele pk5192 1 0 Tc1 Clone pRPRB6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5192_L TATATCGAGAATGAGCCACATCGGTCGGTGAACGTTGATACCAGTCAAGAACATACCCTG NNCGNTTGGAATTGCTCAGGTATAACATTTTTCCTATGAGTCTTACACCTCCGATGCTCC AATTCGATCCTGGTGGGGTATCCATTATTGCTTCATTGCATAAAAGACCAGATGTATCTG TTGATC Allele pk5193 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK5193_L Allele pk5193 1 0 Tc1 Clone pRPRC10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5193_L TACATTGCCTGTATGNACTTTTTCTGCATCATCGCCGTTTGTTTGGAGTACGTTGCCATT TTCATTGTGTTTTTCATATTACGCGATAGTAAAGCTACCACAACATTTAACTCGGCTGCA TAAATGAGGACGACA Allele pk5194 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK5194_L Allele pk5194 1 0 Tc1 Clone pRPRD2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5194_L TATATCCTGATATAAGNATGNNCAATCACCATAGTNCTCTNATTGCATAAAATATATGGC GAGCTTTTGAGTAAGCTGAATAAGGAACTAGCCAGTTAGTCGACANCGTAAATGATGTTA CAGGNAAGTCATTAATTTCTCGTACTTAAAAACCAAAATTCAACATTTTGTTATGGATAT TTATACATCAGTCTGCCTAGGAATGTTACAACTAACAAGTCTGAATATCTTATGACTGAT GA Allele pk5195 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK5195_L Allele pk5195 1 0 Tc1 Clone pRPRD7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5195_L TATATAGAAATAACNAATCAGATTAGCCTACACCATAAATGANCNGGCGNACAGAGTCAA CAACGTGATTNACGTCAGAATGACCGACTAANNAGANANTNTNTNACTATGNCGTTTCTN CCAANANGNNCACGACTCANNCNCAGCAGNCGNANANGGNGTTTCGCNCGNNATNTACCA NCTNNGTAATGATTNTCATAGCGGTTNCCGTACATGGATC Allele pk5196 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK5196_L Allele pk5196 1 0 Tc1 Clone pRPRF11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5196_L TACCTTACGCGTGATTCACCCAGTGCTGCTTCTCCGTCAATTACAACACATGGAATTTTT CTGGGTTCTCCAGCTACTTGCACGAGATTCAATTCGGACCGCAACAACTCGGCGAATTCT TTTTGGCCAGCACTGTATGCAAATGACCTTCATTGCACACCTACAACTGATTAGAGTAAA ATATAAGAATAGACGCTATGATTGATGATC Allele pk5197 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK5197_L Allele pk5197 1 0 Tc1 Clone pRPRF5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5197_L TACATAATCAGCAATGAACTATGAATTGGAAATTAAATCCAATTNTNGTTGCAAGGNTTA AATACATGTNCCATCCAAAANNNTTCTCCCGAACTTAACCCTGAACAACTCACAAATATC CAACGTCAGCAGTCAAGTTAGTTGGCAATTGAGACACAATCANTCCCATACAACAACACT CAGGTTGTCCATATCGTN Allele pk730 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK730_R Allele pk730 0 1 Tc1 Clone pRPMA6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK730_R TAGGTAAATGTCTGGCTGTAAGTTGACATTTTTAATTTTATAAATACATTTCAACACAAC TAAATAGTAAAAAAAACAACCCAAATTTTTAGATC Allele pk731 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK731_R Allele pk731 0 1 Tc1 Clone pRPMB6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK731_R TATTTCTTGTATCCGTCGAACTTTTTCAACTACGTTTTAGCGGCGTTCACCTTTTTCCTG CAGTTTAGGTTAGAAAATCGGTTTTCGTGTCAAGACCCAACACGTGGTGTCAGAAAAGTC CCATTTCGGTTTGATC Allele pk732 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK732_R Allele pk732 0 1 Tc1 Clone pRPMB9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK732_R TAGTTCAACTTTGACGGTCATATTTTTTTCGTCTTCAGTTTTATGAAAAACTTTTCAACT ACAAAAATGGTCATCACTTTTCGTTC Allele pk733 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK733_R Allele pk733 0 1 Tc1 Clone pRPMC2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK733_R TATAACACATCCAATTATGCATGCCAGTCCAATCCAGGACGTACAATTTCTAAAATACTC AAAATCAGAATGATGCCAGATATTATGATC Allele pk734 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK734_R Allele pk734 0 1 Tc1 Clone pRPMF11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK734_R TAGGCTTTTGAACCCTCGATTCGAATCAACAGCAAGAATAGAGGAATAGGCACGTGATTT CCGATAGAGGTTAATAGAATTAACACCAAAAAACTAAATAGTTGTGGAATTCTTTTTGGC CAGCACTGTACATACTATTGCATTGAAACAGTTTTGCTTCTTCAAGATTA Allele pk735 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK735_R Allele pk735 0 1 Tc1 Clone pRPMF7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK735_R CAAGTAACCCACGATTCGTTTGCCACATAATGCAGCTGGAGGAGAAAGGGCTTCATTGNC TGAAAACTGAAAGTCAGAGTATCATTCACTGACGTACAAACAATGAATGAATATTTGGAC GCAAAGTTGTGTTTTCGGAGTCAACATTCTCATAAATTCTTTTGTTTTGTTTTA Allele pk736 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK736_R Allele pk736 0 1 Tc1 Clone pRPMH12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK736_R TATGTTGAGTTTCGGAGCCTTATTAGAAAATCAACCTGCTTCTCAATTCCGCGAACTCCC TTGATAAGTCTGTCAAGCACAGCTCCGACATCAGACCCTTCTTGCATTGAAATGATTCTC ATATGATC Allele pk737 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK737_R Allele pk737 0 1 Tc1 Clone pRPMH3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK737_R TATCAGAATAATGGTATTTAGTCAACTCTGTTAAACAGTCCGATGTAACATGACTGAACA TTGNNAGTAAGTTACTGTCCTATTACATGGAACAGTTGATAAGAATTAAATAAATACCGT TCTTCTGGCTTTT Allele pk738 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK738_R Allele pk738 0 1 Tc1 Clone pRPNA3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK738_R TANATNGCTCAGANAATCATGCATCAATGTTGTTTTCTGGTTGAGTGNNTCTTCATAATC AACTTCCTCATNGTACTATAAATTCAANTTGAAACGTTATAAATCTTNTGAAANCTCACT CCTGGTCCTNTCAGGA Allele pk739 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK739_R Allele pk739 0 1 Tc1 Clone pRPNC5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK739_R TACCTGCGACATTGAGGAGATGCTTTCTTTTCTCTCGCACACATGTTNTNATCNTCATAT GNCTGCAGGNGTTTTAATATCACATTATAAATTCAGTTGATAATCAGAAAACGAAAACAA ATCTNGTAGANTTCTTTATTCCATATTTCAAGCAAATCAAGATC Allele pk740 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK740_R Allele pk740 0 1 Tc1 Clone pRPNG1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK740_R TATGTGAACTCCTTATTGATTTTCCAGAAGCTGACGTTAAGAATATGCATGACGTTGAAT TTCTCCAATCACTGCATTCACATAAGGAGTTGAGGTACGATC Allele pk741 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK741_R Allele pk741 0 1 Tc1 Clone pRPNH11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK741_R TATGTCTNAAGAATATCTATTGATTTATTCTAGGTACCTCCACAATACTTCAATCTCTGT TATTAC Allele pk742 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK742_R Allele pk742 0 1 Tc1 Clone pRPOA10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK742_R TACATACTATTGCATTGAAACAGTTTTGCTTCTTCAAGATTAATCTAATAAAACCTCATG AAACAGAAAATCAAATTGTTTTCAGGAGCTTCCATCTGCTGAATACCATTCAGTTCGTTA CGATGAACGGAATTTGAGTCTTCGAAAAGCACAAGTTGAGCTGAAAACTGCACAAGAAGC TCCAGCTGTTCGAGAGAAAGGAGATGCAAATGATC Allele pk743 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK743_R Allele pk743 0 1 Tc1 Clone pRPOA3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK743_R TAGCTTCACGACCAGTTTTGTTAAGGACTCATTTTCACAGTCATTTNTTGCTAAATTTAG ATTTCGAAATTTTCAAATTAAGAAATTTAGCTTACTTGGAAAACAAACTTCTTTTTNTTT GAACCGCTTTGAAATGCACCTCACAATTTCATTTTCATGTTGAGATTTTCAGAAAATTTT CAGATC Allele pk744 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK744_R Allele pk744 0 1 Tc1 Clone pRPOA4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK744_R TAAATTCTACTGTGTCTTGTTCAAAACATTGAACCATGTTAAAAAAAAATTACGACTATA AGAAAACACAAAATTCTGAGCATTTCGTTTTATTACATACATACTTATCCACTCACCAAT TTCCATTGTTTCAACTTCTTCTATTATTCATAAAAGAGCTTATGAAAAATTCTGGCAAAA CATCGAATACACTCAATTATTTCAAAATTGTTTGCTGCCAGACATTACATCATCAGTTTT TTTTT Allele pk745 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK745_R Allele pk745 0 1 Tc1 Clone pRPOB10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK745_R TATTCAAACGCATTATTTTTTATTGATATCACAGTTTGTTAAGCTATTTTCGTAATTTTC ATTTTTAATCTATTTTTTCAATTCAAATCAAGATGCAGCGATGATACAGTGCTGGCCAAA AAGAATTCTTTTTGGCCANCTNATGGTNTTTAAAAAGAAGCGTTTAAAAAATTGGGTTAA GTAAAAATTATCTTCCAGGCGGTAGATTCACCATGTGTACGCTGTGATC Allele pk746 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK746_R Allele pk746 0 1 Tc1 Clone pRPOC10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK746_R TACATATATGTGAATAAAAAAGCGGNCAACAATGTTATCAAAACATTTATTTGCAGAAAA AACCATAAATGTTGGTANGATATTAATCTCTCCGGTTAGTTTCTTGTGATGNTTAAAAGT CGATATTTTGGCGTTCACACAATTCCTATTTCTGTATGATTTTCCATTCGAATCCAACAC TTGAATGAATTCTTTTTGGCCAGCANTGTATGTTTAAAAAGAAGCGTTTAAAAAATTGGG Allele pk747 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK747_R Allele pk747 0 1 Tc1 Clone pRPOC7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK747_R TACATATATGCAGATTGAACTGAAACTCTGCACCAGTTGAGCGCATCCTCTTTAAATAAC CAATTATAAATTTTCTGTTTCGCGACCATATGGATC Allele pk748 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK748_R Allele pk748 0 1 Tc1 Clone pRPOE12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK748_R TACTTTTGAGATGTTAATGTTCAAATAAGTTGAAACATAGTTAGGTAGACATCAAAAATT ACTTTTTAAATTTTTTTTTCATCATTTTTTTGAATGTATTAGATC Allele pk749 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK749_R Allele pk749 0 1 Tc1 Clone pRPOE9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK749_R TACTGAAAAAATGGTATATGCCGAGTTTTAAGTTGATTCAAAAGTTGATC Allele pk750 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK750_R Allele pk750 0 1 Tc1 Clone pRPOF12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK750_R TATATACAGGTTGGTCAATNTNTTTTAATTTCTAGTTTAATTTCCGTCTCTTTCAGGCAG CCGTATTTTTTCTCAATTTACAATTGCCAATTTTGTATACAGNACTTTCCCAGTTCACCG ACTTTTACAGCCAGACC Allele pk751 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK751_R Allele pk751 0 1 Tc1 Clone pRPOH5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK751_R TAGAGCATTTTTGAAAACTTTGATGAATACATGTATTTCAAGCAATCTTTGATTCTTAAT AGTTGAAAATTATTAGAAGTTGTCGGTTGATTGGTTCATTGAGCCAAGGGGAGGACANCG ATTCTCGTACGGCATGCCGTN Allele pk752 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK752_R Allele pk752 0 1 Tc1 Clone pRPPB4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK752_R TAGATAAAGGGGAAGATGCTGCAGATGCTGGTTCAGCGTTGTGTATATCGAAAGCTAGAA TTTCACAGCGATGTTTGGGGTAATGGGTTTCAAAATTAATATCGCGGAGTGTTATGTTTA AAGAAGAATTCGGAATGTCGGGAGAATCGGAACAATCCCGTCATCTGGTGGCAATCCAGC TCCAATTTTGATTTTGAACATCATTGATTTTTCGTGCTGAATACTTTGTAGATC Allele pk753 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK753_R Allele pk753 0 1 Tc1 Clone pRPPB5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK753_R TACAGCAGAAATATTCTTTAATTTTTCAGCAACTTTCCCGTTTGGATATCACAATACCCC TGAACATGATTCTTGCACATTTCAATCGATGCTTACAAAAACTACGAACAATCGAGATTC CACCACTTTCTGAAAATGATTTGGAAGAAGAAGAAATGTCAGTGCATGTGGTCCTAGTAG ATACACTGGTGCTCCAGATGAAGCTCAATGATTCTGATCGATCAATGACACCTGN Allele pk754 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK754_R Allele pk754 0 1 Tc1 Clone pRPPB7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK754_R TACATTGTTGTAGTTGTCTGAAAGAAGCTAGTATTTTATTAATTACAGAACTACCCTAAG TTATAATTTGGTAAACATTAACCATATTTATCAATCGTTGAAATTGGATAAAGAATATTT TGGAAATCTCTCAGCTCATCCGAAACAGAGTACATAGTGAATTTAAAACTCCAAGCTAAC TGGCGGAATAGGATAAATGGAGAGTTTAGAGAAGCATGTATTTTCTCATTTTCAACTCCT ATCCGCTGGAAATTGGTCAATTTCCTCTTGGCACCGTATACCT Allele pk755 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK755_R Allele pk755 0 1 Tc1 Clone pRPPD11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK755_R TATATCCCAAAATCAGATAAGTTTTTCAAACAAATTATTGGTCGTACTTTTGTCTATATC TTTGCTATTCCCAAATTGTTATCAGCTCTGTAAATCGACAATTATGAAAATTTAAACTTG TTTTAGAGTGTTTCGGTCGATTTGGATC Allele pk756 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK756_R Allele pk756 0 1 Tc1 Clone pRPPD3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK756_R TATACTATCATTATTTTCCCCCTTTCGCAATAAATTCAGTTGTTTACTTGATTTCTTCTC CTCGAAAACAAACTGAATTATAACGGCAAAAATTTCTGCCAAAATCGATC Allele pk757 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK757_R Allele pk757 0 1 Tc1 Clone pRPPD9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK757_R TAGTATTTCAGGTTTTCATTTTTATAATGATAAATTTCTACCATTTTAGAAG Allele pk758 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK758_R Allele pk758 0 1 Tc1 Clone pRPPE10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK758_R TATAAAGCAAAACAAAAGAATTTATGAGAATGTTGACTCCGAAAACACAACTTTGCGTCC AAATATTCATTCATTGTTTGTACGTCAGTGAATGATACTCTGACTTTCAGTTTTCAGGCA ATGAAGCCCTTTCTCCTCCAGCTGCATTATGTGGCAAACGAATCGTGG Allele pk759 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK759_R Allele pk759 0 1 Tc1 Clone pRPPE5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK759_R TATACCATACAAGACCGCTCGAACATGTAGATATTTGATGGGGAATCTGATGAGTAGAGA CTCCAAACCTGCAATATTTTGATTACAAAACAGTTCTTCTGAGACTATTTGAATTAAAAT AAAAGATTTACGTTTTAAACATTTTGAGATTTTCTAGCTTCCGTTTTTTA Allele pk760 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK760_R Allele pk760 0 1 Tc1 Clone pRPPG4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK760_R TATGTTCACATTTTTTGTGCAGGTGTGATC Allele pk761 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK761_R Allele pk761 0 1 Tc1 Clone pRPPG5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK761_R TATTATCCANCGCAAAAGATTTATGTTCAAACGTGTTCCAGGAGATGATTGTTTTCTAAT TCACAATACTCCATATTACTTTAATACATACAGTGCTGGCCAAAAGAATTCTTTTTGGCC AGACTGTATATCTGAAGAATATCTATTGATTTATTCTAGGTACCTCCACAATACTTCAAT CT Allele pk762 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK762_R Allele pk762 0 1 Tc1 Clone pRPOB8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK762_R TAGAACAAAAAGTGATGAACATTTTTGTAGTTGAAAAGTTTTTCATAAAACTGAAGACGA AAAAAATATGAGCCGTCAAAGTTGAAGCTTACGAATTCTTTTTGGCCAGCACTGTATGTG CAAATTTTTTAAAGGAGAAAGGAGAAAGTTTTTTGTTCGAATAACACTTATAAAAATTTC AACAATGAATATGAAGCTTTTCTACCAGAAATGAACCGCGTCCAATCTCTGGCACATCGC AAAAA Allele pk763 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK763_R Allele pk763 0 1 Tc1 Clone pRPOC11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK763_R TAGAACAAAAAGTGATGAACATTTTTGTAGTTGAAAAGTTTTTCATAAAACTGAAGACGA AAAAAATATGAGCCGTCAAAGTTGAAGCTTACGAATTCTTTTTGGCCAGCACTGTAGATA TACTTTAGCTTTTCTTCAAGANGATTTTTTTATGTGTACGGAAAAATTCTTAAATCAATT GGTCTTACCATTGTGTGTAAATGACCGAAATGACCGGCATTTGGCAGGTCCCCATACTGA TA Allele pk5198 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain KR1787 Sequence PK5198_L Allele pk5198 1 0 Tc1 Clone pRPRC12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5198_L TATGTGGAGTTTTGTCAGCAGAATAAGTATCTNCTGATTTGTGGAGGCCAAATGGCGAGA TATAATGTAAGTTTTGGGTCAAAACTACGGTACCTGGTCTCGACACAACAAACATCCTTT TTCATTGCAAAAGAGT Allele pk5199 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5199_L Allele pk5199 1 0 Tc1 Clone pRPE1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5199_L CCGCGTGNCNATNNGNNGNGNCANCACTGTACTTTAGAGCCAGTGTCACCACACANCANC TCGNATCNNCATCANAANCCGNNNNGTCGNGNGCAGANTNNCGNCACANCGCCAANNTCG TGTTGCAGTNGTGNNTNTTGTNCTGATNANCGNGGGTNGGNNGNNNCNCTNCGATNTTTG GTTNNGNATNTANGGNTNTNTGTGGGNNANTTGTNNTNNGGNNGNNTNNNGNNAGNNNNN GTGTGTNCTNGTNG Allele pk5200 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5200_L Allele pk5200 1 0 Tc1 Clone pRPE11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5200_L GCCNTCANGTNTGTGGTCCNAANNTGNNTGGAAATTCACAGTACCTCGAATTTTCAGATT AAATATTTCCGACCAAAGAAATTGAAACTTTAAACATGTTGGTTAAACATATCACATAAG ANTGCGTGTCGAAGGCCTTCACCATCTCANTATTTNCAATGTNGGNCTGNNACGCGTGGG TTAGTTGAGNAAATNCCGGGGNCCNGNGNGNGGTCA Allele pk5201 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5201_L Allele pk5201 1 0 Tc1 Clone pRPE12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5201_L NGNCATCACTGTGGTTCAATGATCAGTTAAATGNTTCACAGAATGCAGAAAGTNCTTCAC GCGGNAAATGGTTTTAAGTNTTNTGGAATCCTCTNNCAGTATAAATGGNNNTCNGCATCA CGCGNTAANGAAAGTCGATNTCNCANNTNATGNNTCGTGNCNNTNGGNANAGTNNGTGNN GNNTANAATNAGGTGGNNGNTGNNNNNTGTTGGNNGNCANNNGNGNGNTA Allele pk5202 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5202_L Allele pk5202 1 0 Tc1 Clone pRPE15 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5202_L TCATCANGTNTGCAACGGTTGGNAGATCACTCCNTCCCAAGGAGAGGACAGCAATTCTCG TACGANCGGTTANAATTCGAGAAGGGAGAGC Allele pk5203 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5203_L Allele pk5203 1 0 Tc1 Clone pRPE16 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5203_L NGANCTNNTACAAGANNCAATGACAATTTGCCTATGACATTTGTTTGTACAGGTACAGGC CTGGCCAAAAAGANTNCTTTNTGC Allele pk5204 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5204_L Allele pk5204 1 0 Tc1 Clone pRPE17 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5204_L NCATCANGTGTGTGGTGGTGTNTGNTAANGCAAANCAAATATGAACTTAACCTGNTGCTG TGCATGATCC Allele pk5205 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5205_L Allele pk5205 1 0 Tc1 Clone pRPE18 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5205_L GTCACCCGGGTTCCTTGGAGTGCGACCTGCAGNCATGCCTNACGAGATTCGATGTCCTCT CCTTGGTTCATTTCACGCNTTTACCAGGACAGTACAAATTTAAAATAGAAAACCGGGNNT TTCTNNNTGNNTAACTNACAGTNCTGTCCAAANNGANTNCTTTTNGTCCAGCACNTAGTN GNANAANNTATNCNGNNTTTNNTNGNGCGNGTGNT Allele pk5206 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5206_L Allele pk5206 1 0 Tc1 Clone pRPE2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5206_L NNNANCGGACNTCANTGTCTNATATAAAACAACACAGTTCCGTNTGTGCCATCAGTTTGT AGTCTATGTAGTCTTTGTAGTCCNGTGACGNGNACACCCAATGNCAATNCGGAGTTGCAG GGNNGTGCGCTAATCACCTG Allele pk5207 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5207_L Allele pk5207 1 0 Tc1 Clone pRPE20 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5207_L GCCATCANGTGANTGTTATGTTCTTCCAAGTGTTNTGTTNTTCATTAGACACCTTTTTTC CCTCAATTCCTCAAAAAGGTGCATCTGTCGTCGCTAGAAAAAGGTTAAGTTCGTCGAGAA CGATGCATGTNGTCTCCGNTTTNNTNNNAANTTGGATTGGCACANGTGNCCTGGNAGNNA ATGGACCTTANTNTNNNNNNNNTGTGNNNGNTNTTNNA Allele pk5208 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5208_L Allele pk5208 1 0 Tc1 Clone pRPE22 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5208_L TTNTNGATTTGAACAAAACACTTTTCCAATAAGATTCCCGTTGTTGGGNTCCAAGGAGAG GACAGCNATTCTCGTACGANCGGTTAGATTCGAGAAGGGAGAGGAATAGCTTANTTNNTC CAAGTAGAGGACAGCNATTNTCGTACGNNCGGTTANGATTCGC Allele pk5209 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5209_L Allele pk5209 1 0 Tc1 Clone pRPE23 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5209_L NCATCCNGTNGGTGNACGGAGTNGCGGCGANCCAATGAGAGGACAGCGATTCTCGTACGG AATTCTTTTTGGCCAGCACTGCAAAATGTGATGTTTTTNTCCGNCAATGTCCTGNTCANT CGAANATTTCAGNTNCAANANNCTNC Allele pk5210 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5210_L Allele pk5210 1 0 Tc1 Clone pRPE24 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5210_L GCCATCANGTGACAGTGGTTCCCAAAGNAACCNATTTNAAATGCGAAAAGGTTTTTTTGA GTTCGCACGNTTAGATCC Allele pk5211 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5211_L Allele pk5211 1 0 Tc1 Clone pRPE25 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5211_L TCCATCACGGTATNATGATNANNNGGCANCACAGTTCCGTTCTGTGCCACAGTTTGTNAG TGCTCATGTCAGTACTTTGCNAGTGCACNNNCGTNCACACCGAGCAGNAACNNNTNAGNG NNCTCCAAGGAGCGNTNAANCNTNNTNGNGTACGGNANTTTNNTNTNTGTGTAGAATGTA NNTNTNNCGTTTGNCTCTCTTTGTNATNGTGANNGNNTTTNNNNCNAATTCNTGNANGNN NGGCGTNNTNTN Allele pk5212 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5212_L Allele pk5212 1 0 Tc1 Clone pRPE26 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5212_L CCATCANGTNANTTGNAAATTCCAGGNATNAGAGAAACATTTAGTAAATTGGTTATTCAA AAGAGAAACAACATTTTGAGTGGGACAGTTGATTTGGGGGNATCCANGNAGAGGNAAGCG TTTCTCGNNCGGCATGCCAANCTNNGCTGAAN Allele pk5213 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5213_L Allele pk5213 1 0 Tc1 Clone pRPE27 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5213_L GTCCNTCANGTGTGTNNNATANNAAAACAANTTTTCATTTGNTTTTNGGTCGTCACTTAT GCAACATAATTNAATTTCAATCGCCTAATGTCTAAAGTATCCAAAATAAATCTAATANGC AAAAGCGTANGNNCCTNNNNGCCAGCACCGNGNTNNNGNGGNACTTGGNTACCAGNGAGN GGGNTNNNNNGCGGGGCNNGTAGGGGNGNNNGGGNGNGNGTGGTGGT Allele pk5214 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5214_L Allele pk5214 1 0 Tc1 Clone pRPE3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5214_L CANGTNACATGGTTACCCAAANAACNGATTTNTNNTGNGAAAAAGGTTTTTTTGAGTTCG CACGATTAGATCC Allele pk5215 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5215_L Allele pk5215 1 0 Tc1 Clone pRPE35 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5215_L CCATCANGTNTGTNNTTGNGAAAAGNTTGGTCCGATCCC Allele pk5216 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5216_L Allele pk5216 1 0 Tc1 Clone pRPE4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5216_L CANCCATCACGNACCATCTNTGTGNTCNCNACCATCTNTTCCAGAGCAATACTCATTGGA GAAATGAATGAAGGGGTCCACAGAGCNCCNCAGAGNTTNNAAACNCGCAGNGNAGNCTTA NNNTANCTTNTGATCNNTGCTNTNTGCCTGCACTNNCAATNGTGANTCCGTTGCACAACN NCACTNNGNCANATGNGNNNGTNGCNTNNGGTNNNAAGNCTTNTNNTTNGTA Allele pk5217 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5217_L Allele pk5217 1 0 Tc1 Clone pRPE5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5217_L NCCAGTANNTNGTGCNNTTTNTATTCCAAAAAAATTTCCGCANTTNGCCAGGTTCTGGTT CTCACTGCTCTCTAAGAAAACCAAACGGTTCATCATATTGCTGCAGATTTCGGTGACAAG TTAGCGATTCGNNGTGAAACCCGTGTGACGTNTAGAGCTGGNCTCACTANCTGCNNAAAN TTNTAGTGNTCATTNGANNGGGNAGNNNTGNGNGTANA Allele pk5218 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5218_L Allele pk5218 1 0 Tc1 Clone pRPE9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5218_L GCCATCANGTGGAAGGGTTNCAAGTTGAACTTGAATGAGATGAGAAGACTATCAACATTT TCTGGCCAACAACTGAAAAAGAAGATCCANGGNGAGGACAGCGATNNTTTGAGTAACGGN TTTGNGTTNTANGTGGGGTGTGGNTGGTGNGTGGNNGGGGNNNGTGNNGGGGNGGGTNTG TGGTNNGTGNGNGGTNNNGGNTTNGGNGTNNAATNGGNTNGGGTTGTTGG Allele pk5219 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5219_L Allele pk5219 1 0 Tc1 Clone pRPFD1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5219_L TAGAGTCGACCTGCAGGCATGCCGTCACGAGAAATCGCTGTGCCTCTCATTGGNTCCGCA TTCAATCCTTTNACCCATATGGTTTCCGCAGTGTACGCTGAAGATTTGTCCGATGGTTGG GG Allele pk5220 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5220_L Allele pk5220 1 0 Tc1 Clone pRPFD10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5220_L TAGTTNAATCATCTCAATGTTNAAAATAATGATTTCAATAATGAGATC Allele pk5221 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5221_L Allele pk5221 1 0 Tc1 Clone pRPFD5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5221_L CCAGTTTTGATGTNCCTTTGCCCAANNTNAAAATTCTGATC Allele pk5222 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5222_L Allele pk5222 1 0 Tc1 Clone pRPFD6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5222_L TATGTTAATGCAGNANGACACANNACGGTTCAGNAAACGGGCTGAAACATGTCAAAGGNT CATTGNTACAAGTTTAACA Allele pk5223 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5223_L Allele pk5223 1 0 Tc1 Clone pRPFF1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5223_L TATTTTATTTTAGGTTAGAACGGTCCTTTTTCAAGCCGCTTATAGTTAGATC Allele pk5224 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5224_L Allele pk5224 1 0 Tc1 Clone pRPFF10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5224_L TAGGGTTGAGACACTGGAGAGGTNGTGTTTACAATTTACAAGACTGNTCCNAGGAGAGGA NAGCNCTTGTNGNCNGCANTGAAGCACTAACTTCANGCAATNATTTNTCNGTCGAATCCA TAGCGCCTGACC Allele pk5225 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5225_L Allele pk5225 1 0 Tc1 Clone pRPFF8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5225_L TATACATTGTNTTACTAATTGTTCTCAAGTCTTTCTATTTCAAATTAAATATTAATTTTT ACAGAAACTGTTTTGACAATTACGTGCTTGTNTGACCATTCACCTCCTCCTCCCCCACCC GGTCCTCCTCGCTCCCCAAAATTCTTGGCTGACATTTCCGTTCAGGAGCTCGTCAGCTCG GCGCGCAGCGCAGGAGGTGTG Allele pk5226 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5226_L Allele pk5226 1 0 Tc1 Clone pRPFG10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5226_L TAGGATTNCTCCGATNCGTANGTCACATNAGATCACTNGGTATNAGCNANATAAACNNAT ATNNGGCNTGACGTAAGGNATAGGATC Allele pk5227 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5227_L Allele pk5227 1 0 Tc1 Clone pRPFG5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5227_L TACACCNGTCAGCACAGATTNACAAACGNNTTNACAATTTTACAAAAGTCGGNGTGTCGT TCCNCCCAGCACCGNCAAAGAACAAACTNCACTAATGGTTATNATCACGTGGCCGGCGNA TGGGCATTTAAATGNGACTAACTGTNTNGCAAAAAACTGATC Allele pk5228 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5228_L Allele pk5228 1 0 Tc1 Clone pRPFG6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5228_L TATATNTATGCTTTACAGAATAGTGCGTGGGAGAGTACACCAAGTTTGTNCACACGGAAG NCACTGNTNC Allele pk5229 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5229_L Allele pk5229 1 0 Tc1 Clone pRPFG7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5229_L TATGTGCATGGCGGTGGTTTTTTGATC Allele pk5230 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5230_L Allele pk5230 1 0 Tc1 Clone pRPFG8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5230_L TATGTTCCTAGTTTCCTGTGTGTAGCCGGTGTCTCTGTGCTCGGNTTCTTCGAAAGTCGC TNCAGTNCTGTCNTNNCAGATTCCGCGGGTCAATTTTCAAGCCTACAGANAGCNANANNT NTATTGTGTTGCATNCTACCTNTGCAANNNGTNTCGCGCNNCCATTGCTANNTAACCCNC NCGATC Allele pk5231 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5231_L Allele pk5231 1 0 Tc1 Clone pRPGA12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5231_L TANTTNACAAGGGCTAAAACTTTACTGAGNTAGTTAAGNGAGCTTACTCATTATCTTAAA ATTTTTTACAGNGCTTNNTNTTTCNGATC Allele pk5232 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5232_L Allele pk5232 1 0 Tc1 Clone pRPGA8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5232_L TAGNGTCGACCTGCAGGCATGCCGTNACGAGAATCGCTGTTACTCTCCTTGGATC Allele pk5233 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5233_L Allele pk5233 1 0 Tc1 Clone pRPGB1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5233_L TATATTCTCTGTTTTNTNCATAATGTTTNAACATTTTTTCAGCCCAACTGCGGAGNAATG CGTGCTCTACGAAGATCGATAGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTA GTAGCTGGTTCCTTCCGAAGTTTCCCTCAGGATAGCTGGATC Allele pk5234 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5234_L Allele pk5234 1 0 Tc1 Clone pRPGB4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5234_L TAGAGTCGACCNGCAGGCATGGAATTNACCTAGAAGGCAGGCGTCCTCAACGTTGATATC AACTCACATTAACAGCCATTCCTGCTCCCCAACCNTCGGACAAATCTTCAGCGTACACTG CGGAAACCATATGGGTGAAAGGATTGAATGCGGATC Allele pk5235 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5235_L Allele pk5235 1 0 Tc1 Clone pRPGD2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5235_L NANTTTGGNAACCCTTGNCCGNGGNAAATGAGTTGGAGTGCATCAAGAATATGTCATTGA TAACTCGGTAGGTCCATTGTTTTTTTTTTTTGGTTAAACAATTTTCGATC Allele pk5236 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5236_L Allele pk5236 1 0 Tc1 Clone pRPGE2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5236_L TATGTACTTAGGTATAGATGTCNTGGAGNTTAAGTTCTGTATCGATCGTTCACCTTCACT CCACTTCGTATGCGCGCACGAGAAAAACNGNTTTTCCAGATC Allele pk5237 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5237_L Allele pk5237 1 0 Tc1 Clone pRPGE6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5237_L TACTTTCAGACAAACGATNCC Allele pk5238 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5238_L Allele pk5238 1 0 Tc1 Clone pRPGE9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5238_L TACTTGCCAAATGGGAGAGTNCATTCACGACTTTTTGTTCACGCTTNCACATGCAGACAG AGCTTCTGNACTAATTTTAAGATC Allele pk5239 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5239_L Allele pk5239 1 0 Tc1 Clone pRPGF12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5239_L TATATGTAAGGANNAAGACAATTGCAAATCTAGATC Allele pk5240 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5240_L Allele pk5240 1 0 Tc1 Clone pRPGF2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5240_L TACGTGAATCAAGGAGAGGACAGCGATTGTCGTACGAACGGTTACGATTCGAGAAGGGAG AGATC Allele pk5241 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5241_L Allele pk5241 1 0 Tc1 Clone pRPGF4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5241_L TAGTTAAATAATCTAATATTAAAATAATGAATTAATAATGAGATC Allele pk5242 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5242_L Allele pk5242 1 0 Tc1 Clone pRPGG1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5242_L TATATATAAACTTACAGTTTTTGAAACAACTTTGCATACTTGGAACTCGTTGCACTGCAC TAACAAACCAATCCGAAAATGAAGCACGAGACGGGAGAGCTGAAAACTTGCACAGTGTAT GGAGACCAAATGCTGGAACCTACTTTTTTCAATCATCTGCTGTTCAACTGTGGGATGATC Allele pk5243 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5243_L Allele pk5243 1 0 Tc1 Clone pRPGG10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5243_L TACACTGGCGCAATTGGCCTGATC Allele pk5244 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5244_L Allele pk5244 1 0 Tc1 Clone pRPGG5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5244_L TAGTTAAGANAGTACANAACACACNGTTTTATAATTTTNNATTTTGTACTGTCCTGGTAA ACGCGTNNNNTGATC Allele pk5245 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5245_L Allele pk5245 1 0 Tc1 Clone pRPGG9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5245_L TACTTTNCCTTGTCAGTTCATTCGGAATCAGGGAGTCATTTGAAAATATTTCTTAGATTT TGGTACTCCACCTTTAAACTCACGTTGCAATTTCTGCCACACAGAGTATTCCAATTGTAT GTGGAGTGGTCGCGCTGCCCAGTGAACAAGTGTCCGTAACGAAAGTCTCAATCACACGGA AAATAATTTTCAAACAATCAGCCCAATN Allele pk5246 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5246_L Allele pk5246 1 0 Tc1 Clone pRPGH11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5246_L TAATAATTCAAAGTTTTGATNC Allele pk5247 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5247_L Allele pk5247 1 0 Tc1 Clone pRPHA3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5247_L TAACGGCGGAAACTCGGGATTAAGAAGATTCCGCTTAGATTACATAGATTATTCCGTGGA TTTTACTATTGTATTAAACGGAATAAGCTTCTCAAACTGGGATC Allele pk5248 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5248_L Allele pk5248 1 0 Tc1 Clone pRPHA4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5248_L TAGCNACAGATGCATTATTCATCAAAGTTACTACAGGTACTCTCGTGTGTATTATCTTTC CAATGAAAATCCAATTTTCAGAAAAGTATAATTGANTTNGCACTTGTTTTATCATCGATT CTGAATATTCNTGATGTGAACGCCCCGTNCCACGAATGGTATAAAC Allele pk5249 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5249_L Allele pk5249 1 0 Tc1 Clone pRPHA5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5249_L TAAAANTTCATAAGAAGTAAATTTTTCATAAGAAGTAAATTTTTCATAAGAAGTAAATAT TTCATAAGAAGTAAATATTTTCATAAGANGTNANTATTTCATACGANGTAAATATTTCAT AAGAAGTAAATCNTTCATAAGCNGNAAATTTTTCAGACGACGCAAAATATTCAAG Allele pk5250 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5250_L Allele pk5250 1 0 Tc1 Clone pRPHA7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5250_L TAGTTTTGCGTTTTTATTCAAAAAAATTTTCGCAAGTTTTCAGGTTCTGGTTCTCACTGC TCTCTAAGAAAACCAAACGGTTCATCATATTGCTGCANTTTTCGGTGACAAGTTAGCGAT TCGCGTCTGAAACCCGCGTACGAACAGAGCTGGGCTCACTCCTTCTCAAAATTGGATATT TCAATGAATATATAGAAATG Allele pk5251 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5251_L Allele pk5251 1 0 Tc1 Clone pRPHA9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5251_L TATGGGACAGCTATCAAATTGCGAGAAAACAAGTTTCATCTTTCCTTTGAAGCTGTGATA TGTTAGTTTTGTGTATTAACTCTCAAATGCCAATTTTCCAGCTCGTTCTCTTTTTCGTTG TCTTCTCTGAAGCTCTGGCTCAAGTTGAGTTTTTTTCCAGCAGGGCATACCTNAACACCG TGCCTG Allele pk5252 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5252_L Allele pk5252 1 0 Tc1 Clone pRPHB11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5252_L TAGATGTNGGACCTGTGTATAACAATTNAGTTTTTTTTTTTCAGAAAAGTGTGTTTTAAT ATAGACATGAAAGTCATATGGTTTTNAAAATTATAATAATTATTAGAAAATGGATCCACA ANACTTACACGTTGCCAGGTCGGTCTCGCTGATC Allele pk5253 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5253_L Allele pk5253 1 0 Tc1 Clone pRPHB12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5253_L TACGTATATAATGCTGTCAAAATTAGTATTACCATATGGTTCTCAGTTTAAATTTACACT TCTTGAAACGATTTTTAAACTTTATTATAATTATTGTAATTATTATTGTGATTAGTTTTT AAAATTTCGAAAACCAGACTGATC Allele pk5254 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5254_L Allele pk5254 1 0 Tc1 Clone pRPHB7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5254_L TAGCAGAGGCGACCATGNGAATGAACGATGTTTAGATTTTTTGAAACNGTAAGNTAAANG CGGTAANTANATCACACGCGNTCTA Allele pk5255 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5255_L Allele pk5255 1 0 Tc1 Clone pRPHC11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5255_L TATNTGGGGCNCTAGTTGTTATGTTCNTNTGCCGTTTCTTATATTTGTATCCTACCAGGN TAGCACGTAACTNGTACCGAGTGCAAGNGAGAGGGATGGGAGGTACTTNCCTNCANCGGC TGCACTGTNTATCCCTCACTCGGTGTAAGCACCGAAATTAATCCAGGNGATGNCNGCGAN TCTCGNACGAACGNTTA Allele pk5256 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5256_L Allele pk5256 1 0 Tc1 Clone pRPHE5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5256_L TATATTTCTCTGAGATTTTGAAAATCAAATTAAAAAAAAAATTTTCATTGTGATAATTAG ATATTAGATTATTAAAAATGTATTCGGGCCAAAAATATAGAGACGAGAAAGGGAGAGGAC AGCGATTCTCGTACGAACGGTTACGATTC Allele pk5257 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5257_L Allele pk5257 1 0 Tc1 Clone pRPHG9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5257_L TATGCTCGNAAAAACTGCTCATTTTGAGCTTTTTCACATGAATTTCTCGAAAAAAAATGC CCAATTTTTCAGATAAATGGTCGCCGGCTCTTCAAATTCGCACGGTTCTTCTGTCGATTC AGGCTCTTCTTTCGGCTCCAAATCCGGAAGATC Allele pk5258 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5258_L Allele pk5258 1 0 Tc1 Clone pRPHH7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5258_L TACATGTAGTTGTTTGGAAAAAATTAGGTTTCCAAAAATATAACATTTTAAAAAATTAGG ATTGAATAAAATTTGAAAAGGCTGAATAGTGTCACTTCAGAAAAAAAANCCAAACTCTAC GACTTCTTCCAAAGTTGCCCTTGAAAAATGATATGGCTATGGGAAAAGTGTCAACTTTTG CCTAATTGGATTAAAATGACAGTTTTGCCGAAAAAACACC Allele pk5259 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5259_L Allele pk5259 1 0 Tc1 Clone pRPKA2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5259_L TAGATGTCGNACCATGCGNGATAAGCAAATTNAGTTTTTTTTTTCAGAAAAGTGCGTTNT AATATAGACATGAGTGTCANATGNATTCATTAAAATNAGNANTAATTATTAGAANANGAA TCCACAAAACTTACACGTNGCCAGGTCGCTCTCGCCGATC Allele pk5260 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5260_L Allele pk5260 1 0 Tc1 Clone pRPKA5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5260_L TAGATTCACGGATAAAAATTACAGAACAGAGTTCACTCCAAATCTCGCTTTTATGGAGAT C Allele pk5261 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5261_L Allele pk5261 1 0 Tc1 Clone pRPKA6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5261_L TATAAGGATTAGGTAGTATTCAGGGCAGGGAGAAAGGTTGAGAATTTTTNCGTGTTTANA AAAATAANTNAGAAAATGGCATTTTTTTTANGGCTATAGAATTGCAATGNNAGGATNCNT GATTGNGGTTTGATCGA Allele pk5262 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5262_L Allele pk5262 1 0 Tc1 Clone pRPKB4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5262_L TAANGTAAGGACCAACACAATTGAAATCTAGATC Allele pk5263 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5263_L Allele pk5263 1 0 Tc1 Clone pRPKB8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5263_L TATCACTTCAAAAAACTATTTGGNAACAACTNNAANTGTATGCTATGTCAANGCAGGCGT TTCTTGAAANTTCACTACTCGGTC Allele pk5264 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5264_L Allele pk5264 1 0 Tc1 Clone pRPKC6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5264_L TATTAACATGTCATTATATCATGTAATGATC Allele pk5265 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5265_L Allele pk5265 1 0 Tc1 Clone pRPKC7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5265_L TAACAGAACGTCACCTGAANTTGTAANTATTTAACATGACNATTTTTCCGNATTNTTCTG TAGTAGCGTANACTTGTTAACANC Allele pk5266 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5266_L Allele pk5266 1 0 Tc1 Clone pRPKC8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5266_L TACATATATTAACATCCAGATC Allele pk5267 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5267_L Allele pk5267 1 0 Tc1 Clone pRPKD11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5267_L TNAGATTTGGATTCTAGATTTTTAAAAAATATATTTGCCGGTTTTCTGGGACAGAAAAGA AATTTAAGCCGCGCTAGAGAGGTTTTTGTGTCGCATAATTCTTTTTGGCCAGCACTGTAC TTTGACCTGAAATTCTCTGTCTTCTTCGTTTCTTTAGATACATGTTTCAAAGTTTGCGAG TAAGANAACAAATAAAGATC Allele pk5268 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5268_L Allele pk5268 1 0 Tc1 Clone pRPKE11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5268_L TACCGTACAATTAAATGTATATGGATATTTGTATTTGCGCTTTGTCGATTTCAAATGAAT TCTTTTTGGCCAGCACTGTATGAGCTGGGAAGCCGCATCCAACCCAGTGGTTAAAGCATG AAACCTTCTTACAGTATGGGCAAAGAAGAAAAGCCGTATCTTG Allele pk5269 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5269_L Allele pk5269 1 0 Tc1 Clone pRPKF3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5269_L TTCCGTTTTTGCATTCANTGTGAAGATGGACTATCAGAGATGGCTGACTCATGTGGGGAA CGTACTCCTTCGTCCCAATGCAACTGTATCGATTTGTACGTTTATAGAAAGGCTTTTGAG TCGATGGCTAAAAATAGAATCATTAATTGTGTAGCAGTAAAC Allele pk5270 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5270_L Allele pk5270 1 0 Tc1 Clone pRPKG10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5270_L TACTTCCAATAGAGAGTCATTACGACTTTTTCTCACGCTTCACATCAGACAGAGCTTCTG ACTAATTTTAAGATC Allele pk5271 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5271_L Allele pk5271 1 0 Tc1 Clone pRPKG3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5271_L TATATGTAGCTACCGTATTGTATATATTAGAGTTACACCCCTCTTTTTTTTTAGTGACAG CATCATTCAGTTAATTTCAGTAATATTGAAAAAAATTTTGAACGATTTCAATTTGTGCTT TCTAAACAAAAAAAAGGCCACCTTTAAAGTTTGGTTTTTCAAAAAT Allele pk5272 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5272_L Allele pk5272 1 0 Tc1 Clone pRPLA8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5272_L TACCCGGGATCCNTAGAGTCGACCTGCAGNNATGCCGTNACGAGAATCGCTGTCCTCTCC TTAGATCATTTTGTTATCGATGTATCAAATTACCCTTAGTCATAACATATACAGTGGNGG CCAAAAAGAATTATTCTTTTTGGCAGACACTGTACTTTAGAGCCAGTGTCACACACAACA ACTCGAATCTTCATCACAAACCGNCACGNCTNTCACAGCTTGGGTTTAAGATC Allele pk5273 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5273_L Allele pk5273 1 0 Tc1 Clone pRPLB10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5273_L TATTCGCCCTTTCACCAGCCCGCACTCCATCANTTAATCATTATTCTTATGCCCAAATAT CTGCTTCAACAGATC Allele pk5274 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5274_L Allele pk5274 1 0 Tc1 Clone pRPLB11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5274_L TATGAGTTGACGTGNGGCTTGACTACATATCTTGAAATTTTTTACAGTACTTAATATTTC AGATC Allele pk5275 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5275_L Allele pk5275 1 0 Tc1 Clone pRPLD1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5275_L TACAACACAATACCAATATGATGACGGTTTGTGGAGGAGAATGGAGGCCGTTAAAAACTA GGAATTTTTTCCTTTGAACAATCGAATAAAAATCGATTTATTTTGACTCGTTTTATTATC GAAAAAATACGATC Allele pk5276 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5276_L Allele pk5276 1 0 Tc1 Clone pRPLF11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5276_L TAGTCCAACGGCAAGATGGAGAATCAGANACTACTGAAAATTCTTTTTGGCCAGCACTGT ATACTCGGCTTCGCTACGTTCAGTGGCTCCGTAGTTTCAACCGTTTGATGTTGCATTTCA GTTCTAGTATACATCAATTTACGGTTTAACGATAACTAGTTCTTCAGACTTCAAGCTCGT TTCGATATTGGTTGNGTAGACATTGGAATTGGTTACTACATCAAAAATAACTTGAAAAAT CTCGTCTTTTATCGAGAAAAAAAAGAGTTCTTGGGCCGTAAGACTGTATAACAAGCGTAT GAGATC Allele pk5277 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5277_L Allele pk5277 1 0 Tc1 Clone pRP1A10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5277_L TACAGGCGATTCTCGTACGAACGGTTANATTCGAGAAGGGAGAG Allele pk5278 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5278_L Allele pk5278 1 0 Tc1 Clone pRP1A2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5278_L TATATTAGGTCTATGATACATTTTTGCATAGATCACGTTGTTCATTTCAGACATTGTTTT CGATTATCTGATCTTAGTTTCATTCTCTGATCTCGCCCATTCACATCAGTGCGTGTNGAA TTCTTTTTGGCCAGCACTGTATGTCGTCCCGAACGCTGAATGGAAATTCACAGTACCTCG AATTTTCAGA Allele pk5279 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5279_L Allele pk5279 1 0 Tc1 Clone pRP1A3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5279_L TACAACACATACCATATGATGACAGCNTTCTCGTACGAACTTTANATTCGAGAAGGGAGA G Allele pk5280 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5280_L Allele pk5280 1 0 Tc1 Clone pRP1B4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5280_L TATTTCTTTATATCCTTCTCTCGTCCGTTCCTTACCTTCGATAGATAGCGTCCTCTCCTT G Allele pk5281 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5281_L Allele pk5281 1 0 Tc1 Clone pRP1C11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5281_L TACGTGAATCTAGATTAATTGCGCCATTTTCTTTGGGTAGAGATCTCCGCCTTTTTTGTA GTTCAAACAGTGATTGGACATTCTGACACCACGAGTAGTCCCTGGGGGATATCAATTCAT CAGGGGAGCACGTTTGCTTATTGAGCTGGATACTAGATTTTCTGGAAAAATACATTTAAA AATTTGCCCTAAAAAATAGCAAACTTTGAACTCCGCATGGAAAATTTAATTTGACATTTT GAAAACATGCCGGCCATTCGATTCTGTTCCCCTTCGTCCCGACCACGCGGAC Allele pk5282 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5282_L Allele pk5282 1 0 Tc1 Clone pRP1C6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5282_L TAATATTTTTCAAAAAAAATAGTACAAAAACTTATGGGACAACCTGATATTAGCAACGTG CTTGATTAAAAAAGAGCAAACAAATTTTCAATTAGTGTGAACATTTCTAATTGAAGTAGG AATTTAGCCGTGAGTACAATAATG Allele pk5283 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5283_L Allele pk5283 1 0 Tc1 Clone pRP1D11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5283_L TATGTCTGATGGGTCCATTACCTAACAGATGGTATTCAAATGCTCGGTTGCATAACAATC TGCTCACTTACTCCATGCCTATCTACGTGCCATAACTGCACAGCTACCTAAGTTGCTAAA CGNTAAAGGTACAGTGCCCCTACAGTACCCTTG Allele pk5284 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5284_L Allele pk5284 1 0 Tc1 Clone pRP1D12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5284_L TAGTATTTATTCTTTGAATAAAATTGCTTGTAGA Allele pk5285 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5285_L Allele pk5285 1 0 Tc1 Clone pRP1D4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5285_L TTACATTATTATATGCACGTGCTAAATATTTATATGTGGAAAACTTTGAGATGACTCTCG AANCAATGCGTTTAGTGTCACAATATATAGTGGAAAGCTGATAATGTGAAAATTATGCAT CATACTTCTGAAANAATACACGTTACGTTACGTACAGTGCTGGCC Allele pk5286 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5286_L Allele pk5286 1 0 Tc1 Clone pRP1D7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5286_L TATGTAGAGCATGTTTTTGAACATTTCAATTAGTTTTAATGTTTTTGTAAATTAAAATCA CAATTTCCAACCG Allele pk5287 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5287_L Allele pk5287 1 0 Tc1 Clone pRP1E11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5287_L TACAGGACAGCGATTCTCGTACGAACGGTTAGCATTCGAGAAGGGAGAGCT Allele pk5288 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5288_L Allele pk5288 1 0 Tc1 Clone pRP1F2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5288_L TATATTAGCAAAATTGAGTTATTTCTAGTAGATAACAATTTTGGTCACAATCAACATGTG CTAAAAAACGCGCTCGGGTTACATACCGCTGTTTCTCGTGTGCAGGGCGGCAAGCTGAAG AAAGGTGGAGATCCGCGTCGCTACCGTGTTTCGCAACGCCGGAACC Allele pk5289 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5289_L Allele pk5289 1 0 Tc1 Clone pRP1F6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5289_L TAGATGTCGGACCATGCTTAACGGTTGGGCATTGATACTTTGGAGAGTACCTAGAGCCAA CAGGACGACGTACCCAGGAATTTCCATCACCCCCGAACAAATTGAACTTGCTTTCGTCAG ACCAGATGTGTTTAGCCCATTCCTGACGTCCCCAACGAGATGCGCTTTTGC Allele pk5290 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5290_L Allele pk5290 1 0 Tc1 Clone pRP1F8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5290_L TAGATTTGCGNTTTTATTCAAAAAANTTTCGCAGTTTTCAGGTTCTGGTTCTCACTGCTC TCTAAGAAAACCAAACGGTTCATCATATTGCTGCAGTTTTCGGTGACAAGTTAGCGATTC TCGTACGAACGGTTAGATTCGAGAAGGGAGAG Allele pk5291 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5291_L Allele pk5291 1 0 Tc1 Clone pRPXB11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5291_L TATGCTCGATGGGTCCATTACCTAACAAGATGGTATTCAAATGCTCGGTTGCATAACAAT CTGCTCACTTACTCCATGGAAGTGCTGGTGAAGCACCCCACACCATGATCCCGTACCACA CTTGCCTGGACAAGGCCATCACGGCTACTTTCACCATAAG Allele pk5292 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5292_L Allele pk5292 1 0 Tc1 Clone pRPXB7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5292_L TATACACTTCACCTCACGTCACCATTTTATCGAGAAGTNTTGTTGGTTGAATGGAGAAGC CGTCGAATAAGGAAGAAGGAAAAAGTAAAATGCGTNTGTNTGGGGCTCTCGGAGCTTTTC TGGAGGGGGCGGACCCCAATTCTCTCTCTTTTTTGCTTAC Allele pk5293 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5293_L Allele pk5293 1 0 Tc1 Clone pRPXB8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5293_L TATACTCTGCATATCGTAAGTTATTTCGAGAATTTTAATTTGAAGTAAGTTTTCAGCACT TATGGATTATCTGGAAATTCCAACATTNATACCCTCTGNCTCTGTTGCTCACGATACTTC TTTGGCAATAGAAATTGGTGAACCAGTNATGCCAAGTGT Allele pk5294 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5294_L Allele pk5294 1 0 Tc1 Clone pRPXB9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5294_L TAGTTGAATCTATAAATATTTCTCAAAAAAAGTTATATGCTGGTTGAGGCTTAAAAACTA CAAACTACAAATCACAATATTTTGCAG Allele pk5295 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5295_L Allele pk5295 1 0 Tc1 Clone pRPXC11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5295_L TACAAAAAATNGTTTCTTTTCATTGTCATTCTCAGTCTAACTAAATAGAGATTCGTAGCA CTACCCCCACAAAATTTAACTAAAATTTTGGGAAACCCNCAGTATCTGGTGGTTGTCAAG GCTGGTGAAAATGTNTAAAATTAATTTTATGGAGCTTAAATGNCC Allele pk5296 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5296_L Allele pk5296 1 0 Tc1 Clone pRPYB10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5296_L TACTTTCAGACAAACGTCTACTGGTTGATGCTCATTCGCCGTCACTTTCTAGA Allele pk5297 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5297_L Allele pk5297 1 0 Tc1 Clone pRPYB4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5297_L TAGTTTTACATCGAGCCGCGACGACACGCAACGCCCGTAAATCTACCCCAGATATGGCCT GGCTTAGTTAGGCAAACTCTTCCATTTAAATTTATGAGGGAGGCCAGAGATACGTGAAAG TTAAAAAAAACCAATTTGATGTTTGCAGATAGTAGTCGGTGGACAGACCGGAAGCTTAAT CTGTTTATCGAGAAAATCGAATAACACCACGGTGAGTAAATNTTTTATGATTTTNNCCAG ACAGTTTCAGATTTTTCTGGTGGAGTACA Allele pk5298 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5298_L Allele pk5298 1 0 Tc1 Clone pRPYB7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5298_L TACAATTTTCTCATGGCCTGCCGCATACATCTGATNAGGCCGACCTGTCGTTCTATCCCC CGATCAGCGATGGCGATGTCGGTTTCGTCGTTGGTCGCGAGGAGCCACG Allele pk5299 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5299_L Allele pk5299 1 0 Tc1 Clone pRPYC10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5299_L TACCTCATAGCTCGTGGAAGTTGAAGCCGTCGAGAAAAGTCTACACGAAAAGTTTAGCCG TTTTATAATCATCTGAAACTTTTCTTGAGTGAATTGAATTTTTTACGGAATTTTCAGTAA CAAAAAAAATAAAAAGGTATGTCCAGCCTTAAAAGGTGTAATATAAACACAAGATATCAA CGTATTTNNTTAATCAAAATTTTTGATGGCGCGAAATTCAACAAAACAAAGANCAAATGG ATAACAGTAAAACAAATAAAGATGATTGTGATATTCAAGACAAAAAGTGA Allele pk5300 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5300_L Allele pk5300 1 0 Tc1 Clone pRPYC2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5300_L CATATAACTCCACATGAACAGGNAAAATTGTTCTATGGCATCTTAGTGTAAATTTTGAGA TTTTCAAATTTGAAGAATAACTTTCTTCAATAATTCATTTAATTT Allele pk5301 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5301_L Allele pk5301 1 0 Tc1 Clone pRPYC4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5301_L TACCTGACATGCATTTTGCCAATCCGGGCCTTCACCCTCCATCGAAAAAGTTCGTTAATT Allele pk5302 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5302_L Allele pk5302 1 0 Tc1 Clone pRPYD11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5302_L TATGTGTTTTACAGACATGGTAACCTTGCGAAACCCCTAGCGTACTTTTAAATTTACTTT GCCT Allele pk5303 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5303_L Allele pk5303 1 0 Tc1 Clone pRPYE1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5303_L TATACGCTGGATANTAGATCTCTCGTTGTTCCGTTTCTCTCAACAGGTCAACTGGTAGCA TTGTAG Allele pk5304 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5304_L Allele pk5304 1 0 Tc1 Clone pRPYE10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5304_L TATCTCGAAAAATGCTCATTTTGAGCTTTTTCA Allele pk5305 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5305_L Allele pk5305 1 0 Tc1 Clone pRPYE12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5305_L TATATGCATACATGTACAGCTTCCGTCATATCCGCACCAATATATACGTGCATG Allele pk5306 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5306_L Allele pk5306 1 0 Tc1 Clone pRPYF11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5306_L TATGTGAAAAACTCTATTATTAATTAAATACATAAATTATTACTGTTT Allele pk5307 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5307_L Allele pk5307 1 0 Tc1 Clone pRPYF12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5307_L TACATCTTGAAAACATAGAAATTGAGAAAAAAATAGGAAAGGATTTGAGACTAAAAATAG ATTCAAGGNGGANAAAAAAGTGCATAAGAAATATGNCCAAAAGANAAAATAACAAAGANA NTTNGGCTCACAAAATAGGTTTCAGGGCTCAATGAG Allele pk5308 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5308_L Allele pk5308 1 0 Tc1 Clone pRPYF6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5308_L TATTATTGAGAATTTTAGTAGCTGCCCTCTTGGTGCAGTTTTGTTTGTTTTTTTCTCATG Allele pk5309 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5309_L Allele pk5309 1 0 Tc1 Clone pRPYG11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5309_L TATTTTCTTTAACTGAAAACATTATGATATTATGATAATAAAATTATTGTTTTATAAAAG TGGATAAGATTATTATAATAGAAAGATAGATAACATTGTATTTGCAAGCTGGATGGGGGT TATTGCTTTTGAATATTTCTATGAAAA Allele pk5310 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5310_L Allele pk5310 1 0 Tc1 Clone pRPYG5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5310_L TATTTTTGAGTTTAAATTTTTTAATTTAAAATTTTTCCGA Allele pk5311 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5311_L Allele pk5311 1 0 Tc1 Clone pRPYG7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5311_L TATATTTGATTCTTCTGATAAAATTGCTTGTGAGA Allele pk5312 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5312_L Allele pk5312 1 0 Tc1 Clone pRPZA6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5312_L TATGTGATAGGAGAAAGCAATTTATATATTGTAGTGATCATTCATTGTTTTCTGTTGATG TTTCTTTTCGCACTTTTNTAGGCGGAAGACGACGGGGAAGATGTTAAAGACGACGCTCTG ACCAGTTGAAAGTGGAGANGCAAGATATTAGAGATTTAGAGAATGAGGCAACG Allele pk5313 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5313_L Allele pk5313 1 0 Tc1 Clone pRPZA7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5313_L TATATATAATCTCNCACATCTGTTCCAGATGCATACTATTGGAGAATGAATGAAGGGGGG TGCAAAACTATTAGAGGTTTGAAACTAGCAGAGGGCTTGATATTAT Allele pk5314 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5314_L Allele pk5314 1 0 Tc1 Clone pRPZA8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5314_L TAATACCCTTTATTAAACTTTCAACAAATAAATTTTCTAACTTTCAAAAGACATTTGTCA ATCTGCAAGCTAGTGTTTCGTCCAATTTTGTAA Allele pk5315 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5315_L Allele pk5315 1 0 Tc1 Clone pRPZA9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5315_L TATCCACCCGTCTTTAGCCTTTATGGGCGAAAAAACAGTCGAGAGGTTGGCGCAATCGAA ATCGTCGCTGACCCACTCGTTTAGTTTCTCCCGATGATTTTCCTCGATGGCTCAATGGGA CCCAAGGCGTTTATGGTAATCGCTGAACCAAAAGGCCAGTTTCCTCCGNCTCGTCCAATT NCAA Allele pk5316 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5316_L Allele pk5316 1 0 Tc1 Clone pRPZB7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5316_L TATGTGTGATTTCAGAAATTTACTACTNTTCAAANAAAATTTTGAAGAAATCTGAATTTG TTCATTTTCAGACGTNTTAAAAATAAAATCTAGATGGTCT Allele pk5317 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5317_L Allele pk5317 1 0 Tc1 Clone pRPZC10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5317_L TAGATGTCGGACCATGAAATTTCATTTTAACAAATACTATTAAAAATGACTCATTTCGAA AACTCACAGGTAGAAGGACGAGTGCCACTTCTTTTGCTGGATCCATTGTCTTAACTGAAA AACAACGTAAATCTTGTGTGGTTTNATACTGATTTCAATGGATTAAAAATATGCN Allele pk5318 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5318_L Allele pk5318 1 0 Tc1 Clone pRPZC9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5318_L TAGATGTCGGACCATGCTTTTTTGGGGGTAAAAGAGCAACAAAATTTTTTTAAACTGGGG AAAGCCGTCCTGGGCTCAGTTTTGCTCCAAACTTAGTGCCGTTTTTTGCTCCACCGTGGG GCAAAATATTTCTAGTAGGATTTCAAATATTAGAT Allele pk5319 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5319_L Allele pk5319 1 0 Tc1 Clone pRPZE9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5319_L TATGTGTGGCATTCACAAGGTAAATTGTTTCTGGTAACACGAAACTTCCATTTTATTTAT TCAGTTGGACTTGGACAAGAAGGAGAAAATTCTTTCCGGATG Allele pk5320 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5320_L Allele pk5320 1 0 Tc1 Clone pRPZF12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5320_L TAATGTTTGATTTTCAGTTTAAACTTCCGATGGATAAGCTAAGTGAATAGTTTTAACCCT AGAAGACAAAGGCTAGATGGAAAATTCCCAAAAAAATCCTTTAATTGATGTAATAGGGTA CGTCAATATTGAACTTTTGATTAAAACATTTTTAGAGTTTCATAAACTATAAGCTTGAAA ATTCAACTATAGACCAG Allele pk5321 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5321_L Allele pk5321 1 0 Tc1 Clone pRPZF3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5321_L TACATGAGATCTCTTGCGTAAAGTCGGCATTGTCTGCGCCCCGGCGCGGCTCTTGTACAA TTGTTG Allele pk5322 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5322_L Allele pk5322 1 0 Tc1 Clone pRPZF4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5322_L TATATTTATTTTTGGAACAAAACTAACATTATCAGCTGGGTATTATTTGAGAATTGTGTA GATCTGCCTTATAGAGGATATTTGCGGTTTTCCTTTTGGGGATTTTAAACAATGATTCAA ATCTCAACTGTCGAATAAAAATTNCTAGAATTTAGCTTCAGATTTNNTGAAAATNTTGGC AAGAACCACGGTG Allele pk5323 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5323_L Allele pk5323 1 0 Tc1 Clone pRPZF6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5323_L TATCTGCAAAACTTCTTTTAAAAAAACAG Allele pk5324 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5324_L Allele pk5324 1 0 Tc1 Clone pRPZG10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5324_L TAATTTCATGAAAAGGTCGCCTAAATCAAATGAAAAAA Allele pk5325 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5325_L Allele pk5325 1 0 Tc1 Clone pRPZG7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5325_L TAGGTCATCATATGTGACGTCATAATCTGTGACTTATTTTTTGTTACGCCATGATTGCTG ACGTCATCAGAATTTTCTGGAAGTTTCTCCAAAATTCTAGAAGGTTCCAGAATTTTCTGA AAATTATATTGGGTTCAGCCTGTGACGTTTACTTAATGTCCTCAT Allele pk5326 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5326_L Allele pk5326 1 0 Tc1 Clone pRPZH5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5326_L TATTTTGAAATAGATGAAATTATTATTAAATTTGCATTGCTCATCACATTTTCAAGTGTA TTGACTCCAATGTAATACTTAGTCTTATTTCTTATTTCTTAAAAGGTAGGCGTAGCACCT GCCTACCAACGCTACCCAAATTTAGAAAAATAAATTGATGTGCCTTAGCGTGT Allele pk5327 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5327_L Allele pk5327 1 0 Tc1 Clone pRPZH8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5327_L TACATGCTATTATCAGCTGACGAAATGTTATAGAGAGGTCATTAAGAATAGTTGGCGAAT TGGTGGAATGATTTTTGGAAATGATAATGNAATTTTCAAAAATCAAAACTTTTGCACCCA TAAT Allele pk764 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK764_R Allele pk764 0 1 Tc1 Clone pRPA1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK764_R GCCATCANGTNNNNGATNTNCNNAAGTTTGTTGCGAACCCAGTTTGTGATCC Allele pk765 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK765_R Allele pk765 0 1 Tc1 Clone pRPA10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK765_R TNNGACAGCANGTNTGTTNATGCTTTTTCTTCAAGTTTTGAACTACAGTGACGTTTTTAT TGACTAAAGGNGCCAAGGAGAGGNCAGCNATTCTCGTACGGNATNCCNCTNTNGGNNNCT TNNTNNTNNCNTNTNNNTNTNCNGNGNANANACTNTNNNCNCN Allele pk766 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK766_R Allele pk766 0 1 Tc1 Clone pRPA11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK766_R TNGTCATCANGTNTGTGTANAATGATTAAANTANTTTTGNTAGCNCCNAGNGGANNTCAG TGTTTGTAACNANGGGTCNCATNANATTGAATGNATCCAGNCAGCAGNNCNNCGATTCNC GTACGTNATGCANTCTTGGCATNGATNAGCACANATAGTCTTTTNCGNNNTGAAAG Allele pk767 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK767_R Allele pk767 0 1 Tc1 Clone pRPA12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK767_R TCTNTTTGGNCAGCATGTATTTNACTGGGAAATATTCGATTGATTCGAACCTNTTGGTTT TGGAGTTTGAAAATCTGGTACATCAAATGAAATCGATCC Allele pk768 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK768_R Allele pk768 0 1 Tc1 Clone pRPA13 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK768_R GTCATCANGTNTGTTNNNAACGAACAAANGAGTCACACACACACACGACGTGGGACATAG ACCGAGACAAAAGCGCGAAATGCGTGCACAGCAGAGTCTCCCAACTACCTGTNTGTCTTC AGAGTAGTAGTGTATATTGGAAGAGATCCAAGGAGAGGNCAGCGNTTNA Allele pk769 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK769_R Allele pk769 0 1 Tc1 Clone pRPA15 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK769_R TNNGCCATCANGTGTNNGTTNTNCANAAGTTTGTTGCGAACCCAGATTGTGATCC Allele pk770 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK770_R Allele pk770 0 1 Tc1 Clone pRPA16 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK770_R GNCATCANGTNAGNATTTTCCAAATGNGTNTNACTGATGCAATTCCAAATTGTCAATTTT NAAGATCC Allele pk771 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK771_R Allele pk771 0 1 Tc1 Clone pRPA17 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK771_R NNGCCATCACGTNTATAGAGTNCATGTTATGATACTAGCACCACAAAGTTGATTGAGTTC GGTTTATTTTCAAGTTACCAGAAACTTTTGAAGCACAAAGCTAAACAGATTGCAATTATN CCTTATCAATTTCCTGANCTCTTACCTGGAAATCTGTGAAGAACGC Allele pk772 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK772_R Allele pk772 0 1 Tc1 Clone pRPA18 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK772_R GTCATCANGTTACCGAGTGTGAGCCAGGGTGTGTATGAGGCCGCAATGAACAGGTAAATG GCCGCCCGATCCAAGGAGAGGACAGCGATTCTCGTACGAACGGTTACGATTCGAGA Allele pk773 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK773_R Allele pk773 0 1 Tc1 Clone pRPA19 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK773_R NGCCATCANGTNNNTNNGAAANNNTTCAGTTNACAGGTTACCAAGGAGAGGACAGCAATT CTCGTACGAACGGTTAGATTCGAGAAGGGAGAGCGATTCTCGTACGAACGGTTACGATTC GAGAAGGGAGAC Allele pk774 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK774_R Allele pk774 0 1 Tc1 Clone pRPA2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK774_R NGCCATCANGTCACANCCNGNNNTGCCATGGAGACACGNNGTTGNTGCCNNAANCNTGGA GAGGTCANTTGGCCATAAAGGATGTCAGAGGGTCGGAATGATGTTCCCACGTTNAGATAT CATCGTTTAGACTTGATCCAAGGNGCGNACAGNNATTNTCGTAC Allele pk775 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK775_R Allele pk775 0 1 Tc1 Clone pRPA21 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK775_R TNNGCCANCATGTAGTACAANTACAATCGATANTGACCCCAAAAGTGCCAGGATACGGGC GGGGCCTATTCACAATTAATTCGCGATCC Allele pk776 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK776_R Allele pk776 0 1 Tc1 Clone pRPA22 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK776_R ANGTCATCANGTNTTTTATNCCCAAAAAAATACGACACAGTGACATACAAAANGCTACTA ATCNATCTGGNTCCAAGGAGAGTNCAGCGATTNTCGTACGTNCGGTTACGATTCGAGAAG GGAGANAAGGAGAGNNCAGCGATTNTNGTNCGTACGGTTACGATTCGAGNAGG Allele pk777 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK777_R Allele pk777 0 1 Tc1 Clone pRPA23 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK777_R NNGCCATCATGTGTTATAATCCAAAACATTTCCAAGTCAACACAACGTTNTGCCAGTTCC AAGGTGAGNNCAGCGATTNTCNTACGANCGTTTACGGTTCGAGAAGGGTGAGAGGNNGAG GACAGCGATTCTCNTACGANCGNTTACGNTTCGAGNAGGGTGAGNNC Allele pk778 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK778_R Allele pk778 0 1 Tc1 Clone pRPA24 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK778_R NGTCATCANGTAGNTAAATGTNAGTCCCGGCATTGGAAATCGAGACGTATGTNATATTGA AAGCTTAAGGTTAGCCTAGATCC Allele pk779 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK779_R Allele pk779 0 1 Tc1 Clone pRPA25 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK779_R NCCATCACGTNNTTGGCNTACGGTNGCAACNGAGTAACCCTGCTGACACATCACATATTT NGCNTAACAATCTTNATAGTGGTTTTAAAAGTNNTAAGCTNTTCTNNAATCNNGNGCACG TCAAANNCANGNNCAANGNTCAGACCCAAGGNGNGGACAGCGANTCTCN Allele pk780 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK780_R Allele pk780 0 1 Tc1 Clone pRPA26 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK780_R GTCATCANGTNTNTGNTCCCGAAAAAACATTCAAAANNAAAATCCCACAAGTATAAGCCG TATTTTCCCTACTACGGAAAGAGCAGGTTCTTGAATCATAGGACTTTTAATGGGGAAGAT CCAAGGAGAGGACAGCGATTCTCGTACGNNCGGTTACGATTCGNGAAGGN Allele pk781 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK781_R Allele pk781 0 1 Tc1 Clone pRPA27 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK781_R NTGACATCANGTNAGTACAAACCAAAACAACCAAAATTTTTTTNTTTTCCGAGAATTAGA TGCGATCCAAGGAGAGGAGAGCGATTCTCGTACGAACGCTTACGATTCGAGAAGGGAGAG GACAGTGATTNTCGTNCGAACGATTACGATTNNAGANTAGTGAGCAAT Allele pk782 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK782_R Allele pk782 0 1 Tc1 Clone pRPA28 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK782_R GNCATCANGTNTGTTAGTTNTNCAANTTCACTTGGGNATACCNGGAAAAAANCTNTTGNA GGGCTNACTTGTGAATGNAAGNNCATCTNNGNCCNCATGGACAGTANNCNNTTTGANGGA CNGACTGTCAGGCCTCTGGNTNGTACTTNGGGTGTCGAGGNACTGGTCG Allele pk783 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK783_R Allele pk783 0 1 Tc1 Clone pRPA29 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK783_R NNGCCATCANGTNTACAGTAATNTCACATATTGTGCCAGAGGNTNCTGAAGNTTATAAAG NNTTTANANGTGAANNNTTGGNAACANATCTACCTCATAAGCCNACATCCGNCGGTGTCC AGTCTCTGACATTGGGTGGCTCGTCGAGCCAGGCAANGTGCCANN Allele pk784 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK784_R Allele pk784 0 1 Tc1 Clone pRPA3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK784_R CCATCATGTTGNTTAGGTTGAGAAGATCCTTTAGTACATTGTTGGCCAGATCCAAGGAGA GGACAGCNATTCTCGTACGAACGGTTAGATTCGAGAAGNGAGAGGACAGCGATTNTCGTA CGAACGNTTACGNTTCGAGANGNGAGAGGACATCGATTNTN Allele pk785 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK785_R Allele pk785 0 1 Tc1 Clone pRPA30 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK785_R CCATCANGTCTGNANCTTGACNTTTTGCAACAACTGGGCATCTCTTAACTTAACAAGTAC TAGATCC Allele pk786 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK786_R Allele pk786 0 1 Tc1 Clone pRPA31 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK786_R NGNCATCANGTNTGTNAAANNTTGCACCAATGGGGTGTCAGGTNAACTTTTNAACCAAAA ATCAGCAGAAGCTTGGNCTACATGTTAGCATTANGGGTTTGCTAAAATTTGATCCAAGGN GAGACAGCGNTTCTNGTACGAACGGTTACGATTCGAGAAGGGAGAGAGGA Allele pk787 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK787_R Allele pk787 0 1 Tc1 Clone pRPA33 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK787_R TCNATCNGGCAGCATGTCACTTCAAAACCNTGTTCAACTGNTCGCTGGGCATATGNNGAA GTTCTGATAGANGATCC Allele pk788 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK788_R Allele pk788 0 1 Tc1 Clone pRPA35 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK788_R ACAANATTNTNCNCAGTNACATTGAGCATTACCGNAGGGTGAGAACAGCGATTCGCGTAC GAACGGTTAGATTCGAGAAGGNAGAGCAAGNNGAGGNCAGNGATTCTCNTACGNNATANA ANTTTTNNGTANTNNTTNT Allele pk789 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK789_R Allele pk789 0 1 Tc1 Clone pRPA4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK789_R TCNGCCATCANGTAGACCCAAGGAGAGGACAGANATTCNCGTACGANCGGTTANATTCGA GAAGGGAGAGA Allele pk790 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK790_R Allele pk790 0 1 Tc1 Clone pRPA5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK790_R GCCATCANGTCAGTTACANTNACATNGCTAACTCAACCCCAAAAGTGCCAGGATACGAGC GGGGCCTATTNACAATTAATTCGNGATCC Allele pk791 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK791_R Allele pk791 0 1 Tc1 Clone pRPA8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK791_R NNNNTCGGTCGCATGTATACCACTTNTTCTAAATTTACAGTAATTCTGGTAATCGCGTAC ATAATCANTTATCTNCAAACTTNCCCTCACTACAAATNGCTGATGCCATGCTAGCAAATC ANTCATNCAGATTCACTTTNTGTCATCAAATGANCTGTGATTNGCTT Allele pk792 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK792_R Allele pk792 0 1 Tc1 Clone pRPB1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK792_R NGTCACCNGGGNNNCCNNAAGTGTGCGACCTGCAG Allele pk793 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK793_R Allele pk793 0 1 Tc1 Clone pRPB10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK793_R TCNCAANTGGNGTTATAACGGANAAACGTCACGNGAGTAGNTCTCCCATGATCC Allele pk794 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK794_R Allele pk794 0 1 Tc1 Clone pRPB11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK794_R GNCATCANGTNTGACTTTGCACNTGTTGNAACAATGGCATGTCTTAACTTAACAAGTACT AGATCC Allele pk795 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK795_R Allele pk795 0 1 Tc1 Clone pRPB12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK795_R TCCGCCATCACGTGGNNTTGGAGCTGACCAACGGTACAGCCCATTGAATGNCTGTTTCAN NGAGTTGGTACTATAGNTGCACTCGNCAAANGGNANCNGCNGNGTACACNTGCCCC Allele pk796 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK796_R Allele pk796 0 1 Tc1 Clone pRPB13 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK796_R GCAGTCANGTGTTGATGGGCCAACCGNACAGANCTATGTTNATGAAAATGNTCC Allele pk797 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK797_R Allele pk797 0 1 Tc1 Clone pRPB14 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK797_R ANNGGGGTTATCAACGGAAAAACGTNCACGAGNGTCAGGTTCTCCCATGAATCCC Allele pk798 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK798_R Allele pk798 0 1 Tc1 Clone pRPB15 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK798_R NGTACCNGGGNTCCGTGGAGTGGACCAN Allele pk799 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK799_R Allele pk799 0 1 Tc1 Clone pRPB16 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK799_R TNNNCCATCANGTAACCCTTNTCGAATTTTTCCCAAGATTTTTCAANCC Allele pk800 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK800_R Allele pk800 0 1 Tc1 Clone pRPB18 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK800_R NCCNNCATCACTGTNNTTTGTNTNTNACTTGTGCNCTTATNTCCACACCANGTTGNAAGC NTTCCAAGAGGCTCCCAGNGANTNTTTATCATACACATNNTCCANGNGGAGTCAGCNNTT NTGNTNCGTCNNGTNNAGTTTTTTTNNNTTTNGAGTTNTTTGNTT Allele pk801 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK801_R Allele pk801 0 1 Tc1 Clone pRPB19 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK801_R NGNCATCANGTNTNNGTTNTNCNATNAGTTTGTTGCGAACCCAGNATTGTGNTCCAAGGA GAGGACAGCGATTCTCGTACGAACGGTTACGATTCGAGAAGNNTGAGTNCANNGATTNTC NTANGNTNTTNAANNTTGTTTANTTTATGGTNNNAGNNNA Allele pk802 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK802_R Allele pk802 0 1 Tc1 Clone pRPB2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK802_R NCCNNNTNGGGGTTAATCAACGGAAAAACGTCACGAGAGTAGGTCTCCCATGATCC Allele pk803 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK803_R Allele pk803 0 1 Tc1 Clone pRPB22 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK803_R NNGNCATCANGTGTGTGTGATNTNTTCAAGCATTTTTGGTAGATCC Allele pk804 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK804_R Allele pk804 0 1 Tc1 Clone pRPB23 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK804_R GCCATCANGTNGTCATNCNGATACCAAGGAGAGGACAGCATTGTACGTACGAACGGTTAN ATTCGAGAAGGGACAAGGAGAGGACAGCGATTCTCGTACGAACGGTTACATTCGAGAAGG GNGAGANGAGAGNACAGCGATTCTCGTACGTACNN Allele pk805 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK805_R Allele pk805 0 1 Tc1 Clone pRPB24 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK805_R NNGCCATCANGTACGTGNTNTCCAAGCAGAGATTNGTTCACCTCTACANTANNNTTNTNT NGCGTCGGCAGNTNGGCAGGCAGGCACATGAAAGGCGTTTATGCCTACCATTGAAAAATG TTCAACTTACGATTCATCCCAAAANTNTTAGGAGTC Allele pk806 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK806_R Allele pk806 0 1 Tc1 Clone pRPB25 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK806_R CANGTGAANTTGCCAAGGAAAACCCTNAAANTNCGACACGTNATTCCTTTTTCCTTCTAG GGGGCAGACTGAGTGTGTCTCACGTGGTGTCAGGCTGATTTGACCTGCAAAAAATGCGGG CATTTTNAGTCCAGAAAAAGTGTGACGTCACCAA Allele pk807 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK807_R Allele pk807 0 1 Tc1 Clone pRPB26 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK807_R NNNCACCACGCGAACCTTNGNGNANGACCGTGNAACC Allele pk808 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK808_R Allele pk808 0 1 Tc1 Clone pRPB27 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK808_R NCATCANGTGNCNGNAGAGAAAGCTNTCAAGTNCAAAATNNTTGAGNNCC Allele pk809 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK809_R Allele pk809 0 1 Tc1 Clone pRPB28 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK809_R CNNNNGGCNGCACGTGACATAAAANTGCAATGNNCTGCAAACCAGATTTTNGTATAANTC AAATAAAAGTNTAANTAANTNTNTNNTGAGANANANCCAAACANNCTTNNNTCCAGGCGT GACCTAGTAGCATTNNCAGANCCANGGCGAGGACAGCNA Allele pk810 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK810_R Allele pk810 0 1 Tc1 Clone pRPB29 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK810_R CCATCANGTGTGCNNCCGGANGACGTGGACAATTAAGCCAGCATNTCAAGGTTTCGGCCT TCATAAACACATTAGGCTTTGATCC Allele pk811 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK811_R Allele pk811 0 1 Tc1 Clone pRPB3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK811_R NCCATCANGTNATGAGCAAAAACAATTCGNTAACTGNACCCCAAAAGTGCCAGGATACGG GCGGGGCCTATTCACAATTAATTCGCGATCC Allele pk812 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK812_R Allele pk812 0 1 Tc1 Clone pRPB30 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK812_R NNNCGCATCATGTNACANATTCCAGNTNACCTTTGAAAATCCACCATTTTTAATCTCCGA TCC Allele pk813 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK813_R Allele pk813 0 1 Tc1 Clone pRPB31 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK813_R CCATCANGTCGNANCCANNNGNAGGACAGCAATTGNACGTNACGAACGGTTANAATTCGA GAAGGGAGAGGACAGCGATTCTCGTANGANCGGTTACGNTTCGAGAAGGGAGAGAGGACA NCNATTCTCGTACGNCATGCCTGNCTCANCTACCNNTN Allele pk814 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK814_R Allele pk814 0 1 Tc1 Clone pRPB32 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK814_R NNTCATANACTGAAAGTNATCACCANCAGNNCAGTCTNNNTAGACCCAANGNAGAGTNCG GCANTTCTGNTACGNCATNCCACATNNGNNNTNNTCACGGCATATAGNNTTTNCNTNTTT ANANTNATNNNTCNTTCNNATNTNCANNNATNATCCGNT Allele pk815 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK815_R Allele pk815 0 1 Tc1 Clone pRPB33 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK815_R NNTCANGANCGAAAANCNACAGNGCGTAGGTTTCCCTNTTCCC Allele pk816 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK816_R Allele pk816 0 1 Tc1 Clone pRPB34 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK816_R NNNCNNNGGCNNCANGTACTTGTTTCAAGCAGTGCTAGGTGAGTATTTGAGAATATTTNT CCTACTAAATATTACTNTTNAANCTTNCCTATATNNNNAANTNTCCAGATCC Allele pk817 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK817_R Allele pk817 0 1 Tc1 Clone pRPB35 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK817_R NCCATCANGTNTNNGATNNNGNACAGAAGGAGGGTGTTTGTTCCGGCGATCC Allele pk818 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK818_R Allele pk818 0 1 Tc1 Clone pRPB4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK818_R GTGNNTNNNGGCCAGCACTGTCATCANCAANCGGGNCCATGNNTGGTGGCTNTCATGTGG CCAANCTCNATCAGGANTCTCCGCTTNCTTTNTGCCCAGCNCTGTAAGTNAATCTNGTCC CGNNCTGCGNANNCGAGACGTATGTCNNTTGAAAGCTTAAGGAA Allele pk819 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK819_R Allele pk819 0 1 Tc1 Clone pRPB7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK819_R GNCATCANGTGTNTGTGTGTGTGATATGAGAATTCACTGAACCATATAACCTGTGGGAAT TTTCCTAGTAGAAAATATTAACTCACCTCAAANGTATGTACTTNNCCTTGANCC Allele pk820 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK820_R Allele pk820 0 1 Tc1 Clone pRPB8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK820_R TNNNTCATCATGTNTNAACCTTTTGTCTTAGATCCAAGGAGAGGACAGCGNTTCTGCGTA CGAACGGTTAGATTCGAGAAGGGAGACAAGGAGAGGACAGCGATTCTCGTACGAACGGTT ACGATTCGAGAAGGGAGAGTACAGCGATTCTCGTA Allele pk821 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK821_R Allele pk821 0 1 Tc1 Clone pRPB9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK821_R TTNGCCATCANGTCNNNCCCAAGGAGAGGACAGCAATTGTNCGTACGAACGGTTANATTC GAGANGGGAGAGGACAGCGATTCTCGTACGAACGGTTANATTCGAGA Allele pk822 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK822_R Allele pk822 0 1 Tc1 Clone pRPBC12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK822_R TAGAAAATTNCATTGTNTAAAATNGGAGCACAAACCGATC Allele pk823 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK823_R Allele pk823 0 1 Tc1 Clone pRPBD1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK823_R TNANGACAATGACANGCGNTNACTCAACCCCAAAAGTGCCAGGATACGAGCGGGGCCTAT TCACAATTAATTCGCGATC Allele pk824 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK824_R Allele pk824 0 1 Tc1 Clone pRPBD3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK824_R TATCTGCTTTNCGNTTNNCANNAGTNTTGGTANGACCANAANAAATCAAAATNAGGAGTT GTGCGCACATCATTTTGTAAAAGAGNGANGATC Allele pk825 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK825_R Allele pk825 0 1 Tc1 Clone pRPBD6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK825_R TATCAAGGAAAAANTTCACGAGAGTAGGTTTACCCATGATC Allele pk826 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK826_R Allele pk826 0 1 Tc1 Clone pRPBD7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK826_R TATNAAGTGCCACCGATCNATCANACCCGAGAAAGAGTAGCGATTTTTCNAGTACTTCGC TACGAACCAATGGGTTTNTNAAATTCNTNACATTACAAAAAANTTGANGATC Allele pk827 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK827_R Allele pk827 0 1 Tc1 Clone pRPBD9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK827_R TATGTTNTTTNATGATTTCCATTTGACAGAGACGTGAGATC Allele pk828 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK828_R Allele pk828 0 1 Tc1 Clone pRPBE10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK828_R TATTNCAGCCACCAACAAGTGGTNCCAAATNTAGCTGACATCATATCGGATCTGGTTCAA AGATCAACGACAGGGGGCCGTGGTGGTGGATC Allele pk829 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK829_R Allele pk829 0 1 Tc1 Clone pRPBE2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK829_R TACTTGCAACTTCCAGCGAGCCNCACCTTTTCCAACAACTGTGTGGNCAAAAATGAAAGT TATGATTTNTTGGAAATTCCCGAGGGAACGTTTGATGAAATTNCAATGTCCGAAGATGAT C Allele pk830 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK830_R Allele pk830 0 1 Tc1 Clone pRPBE4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK830_R TATGTTCTTTCATNATTTCCAATTTGNCAGAGACGTGANATC Allele pk831 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK831_R Allele pk831 0 1 Tc1 Clone pRPBE6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK831_R TACTTGCTTTNNAGCAGTGCTAGGTGAGTATTTNANAATATTTTTCCTACTAAATATTAC TNTTNAANCTTTCCTATATNTCCAAATNTNCAGATC Allele pk832 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK832_R Allele pk832 0 1 Tc1 Clone pRPBF1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK832_R TATGTTCTTTNNTNATTTCCAATTTGCAGAGNACGTGNGATC Allele pk833 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK833_R Allele pk833 0 1 Tc1 Clone pRPBF11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK833_R TATATNATCCAGTGNGNAAAACATTTCAGGTGATC Allele pk834 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK834_R Allele pk834 0 1 Tc1 Clone pRPBF12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK834_R TATATCTGGAGTAGTCTGATATAGCTCACCACCAGGNCAGTGTGACCTGNATTCCCAGAT C Allele pk835 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK835_R Allele pk835 0 1 Tc1 Clone pRPBF5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK835_R TACANNTNCACTAACCTTGANAANNCACCTTTTTNATCCNCCGATC Allele pk836 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK836_R Allele pk836 0 1 Tc1 Clone pRPBF6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK836_R TNATGTTAGATATTGCAACTNTNTAAGNTCNNATTGAAGGCGNTNTTTNACAATCACAAA GCGNACTGCTNTACTNCCTATGNATGATC Allele pk837 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK837_R Allele pk837 0 1 Tc1 Clone pRPBF9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK837_R TAGNTNAATGTGGTACCCGGANNTNGNATGCGAGAACGTNTGTCATATTCGNAAAGCTTG AAGGTTAGCCTAGATC Allele pk838 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK838_R Allele pk838 0 1 Tc1 Clone pRPBG8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK838_R TATAAGNNCCACCATNANCTANTCCCGAAGAAAGAGTAGCGCTTTTNCNAGTACTTCGCT CGAACCAATGGGTTTCTNAAATTCNTNACATTACAAAAAANTTGANGATC Allele pk839 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK839_R Allele pk839 0 1 Tc1 Clone pRPBH11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK839_R TACACGGGACTGCATGGGNNAAAAGTANGATGNNTTAGCNTGNCNCATGANAGGATCATC AGNGGNTCGNNNTGCTGTTCCCACGNTNNGATATCATCGGTTAGNATTGATC Allele pk840 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK840_R Allele pk840 0 1 Tc1 Clone pRPBH12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK840_R TACTTCATNTGGTAAATTCTGCACGAGGANGTCAATGAGAAACACCTCTATAAATGTANT TATGACAGCAGCGGCGATCTCGGACATTTGCTATTTACTNATAGTTGCCTCAAGANTTTA TCTCCTTATAGGNATGTATACTGATC Allele pk841 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK841_R Allele pk841 0 1 Tc1 Clone pRPBH5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK841_R TATTNCANGNTTGTTNNNNAAAAGAGNTCAACTCACTGAAAATGCATCACTTTNGCAAAG TAATGTTCTGCTTGTNAACTTTGCTCGTCCTTAGTNCCTGCAGCATGTTTCATGGAGANG CTCAATGTGAAGTGATC Allele pk842 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK842_R Allele pk842 0 1 Tc1 Clone pRPBH8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK842_R TANCNCCAGATTGGGGTTAATAACGGAAAAACGTCACGAGAGTAGGTCTCCCATGATC Allele pk843 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK843_R Allele pk843 0 1 Tc1 Clone pRPBH9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK843_R TATAGTGCCACCNTGGNTNACTACCNGAGAAAGAGTCAGCNNTCTTTTCNAGTNACTTGC GNTTCGAAACCAATGGGTTTCTNAAATTCNTTACATTACAAAAAANTTGAAGATC Allele pk844 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK844_R Allele pk844 0 1 Tc1 Clone pRPCA10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK844_R GTTATAACGGAGAAACGTCACGNGAGTAGNTCTCCCATGATC Allele pk845 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK845_R Allele pk845 0 1 Tc1 Clone pRPCA2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK845_R TAATCAACGGAAAAACGTCACGAGAGTAGGTCTCCCATGATC Allele pk846 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK846_R Allele pk846 0 1 Tc1 Clone pRPCA8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK846_R TATAACCTTTTATCATTAGATC Allele pk847 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK847_R Allele pk847 0 1 Tc1 Clone pRPCB12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK847_R TACGTGNTNTCCAAGCAGAGATTNGTTCACCTCTACANTANNNTTNTNTNGCGTCGGCAG NTNGGCAGGCAGGCACATGAAAGGCGTTTATGCCTACCATTGAAAAATGTTCAACTTACG ATTCATCCCAAAANTNTTAGGAGTC Allele pk848 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK848_R Allele pk848 0 1 Tc1 Clone pRPCB2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK848_R TATCAACGGAAAAACGTNCACGAGNGTCAGGTTCTCCCATGAATCCC Allele pk849 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK849_R Allele pk849 0 1 Tc1 Clone pRPCB7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK849_R TNATCTGATTCTTCTCNATCAGTTTGTTGCGAACCCAGATTGTGATC Allele pk850 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK850_R Allele pk850 0 1 Tc1 Clone pRPCC10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK850_R TACTTGCTTTAAGCAGTGCTAGGTGAGTATTTGAGAATATTTNTCCTACTAAATATTACT NTTNAANCTTNCCTATATNNNNAANTNTCCAGATC Allele pk851 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK851_R Allele pk851 0 1 Tc1 Clone pRPCC3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK851_R NCATCANGTGNCNGNAGAGAAAGCTNTCAAGTNCAAAATNNTTGAGNNCC Allele pk852 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK852_R Allele pk852 0 1 Tc1 Clone pRPCF12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK852_R TATNTNTTCNCCAAAAAANCACGAACACNGTGCATGCAAAAAGCTNACTCAATCATCTGG TTCCAAGGNGAGGACAGCGATTCTCGTACGCACGGTTACGATTCGNGAAGGGNACAGGAC AGCGATTCTCGTACGGCATGNCTGCAGNTCGACTCTAGAGGATC Allele pk853 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK853_R Allele pk853 0 1 Tc1 Clone pRPCF9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK853_R TACGTGAATCCANNAGNGNACAGCGATTCNTTNACGNACGNNNACGATTCGCGCAAGTGA GAGAACAGCGATTCTCNNACGACGCNTCAGATTCGAGCAGCNGTTCCCAAGTGGAGGCCA NNGTTTCTCTTNCGNACGNNTACTNTTCGTGANNATGGANCAAGCTGAGTCCAGCGTTTN TCCTNCGNNCNCTNACAATTCNAGA Allele pk854 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK854_R Allele pk854 0 1 Tc1 Clone pRPCG1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK854_R TAGNTAGAANTCAAANGCTCGTGTGAANNTCAGTGCANCTGCCTNCCACCTATGCACTNT TCNNGCATGCATGCANAGCTGNCAAATGNATNTGACCNTGCCAAACATCANTATTGACGN TGATGGTAGNGACTNAGNGCTTGAAG Allele pk855 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK855_R Allele pk855 0 1 Tc1 Clone pRPCG11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK855_R TACTTGCNNNNNTNANGANNCNCGAGCAAGTCCAACAAGTAGTNANCTCAAATAATGNAN GAGNNTNNTACAGTNGNGGNTTCCTNGGGCANCG Allele pk856 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK856_R Allele pk856 0 1 Tc1 Clone pRPCG4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK856_R TATGTGNAANNANATACCAAAGCAGTTTNAGGTGAACTTTTAAACCAAAAATCAGNAGNN GCTTGGCACTACATGTNAGCATT Allele pk857 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK857_R Allele pk857 0 1 Tc1 Clone pRPCG5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK857_R TATCAANAGCTNATTNCCGTCTGTTCACTGAGGTNCACAAATGANTCANCATACATTGCA GCGCTGGAAATTATTTTAGAAAATTTTNAGGCTACTTATGATGAATACGCACCCGACATC GATC Allele pk858 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK858_R Allele pk858 0 1 Tc1 Clone pRPCG6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK858_R TATGNTGTTNGTNNTTGTTCAGNTTTCACTGAACCATATNAACCTGTGGGATNTTCNCTA GTAGAAAATATTAACTCACCTCAAAAGTATGTACTTTNCCTTGATC Allele pk859 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK859_R Allele pk859 0 1 Tc1 Clone pRPCG7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK859_R TATCATCGAACGAACAAACTAGCACACACACACACACGAACGTGGAGACATNAGACCGAG ACAAAAGCGCGAAATGCGTGTCACAGCAGAGTCTCCGAACTACCTGTNTGTCATTCAGAG TAGTAGTGTATATTGGAAGAGATC Allele pk860 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK860_R Allele pk860 0 1 Tc1 Clone pRPCH1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK860_R TAGTGAGCTATTGNNCCAGTTNACACACTGAACNAGCCATTTCAAATGATC Allele pk861 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK861_R Allele pk861 0 1 Tc1 Clone pRPCH10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK861_R TATATGCACGCGAAAGCTTTCAAGTTCCAAAATTNNTTGAGATC Allele pk862 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK862_R Allele pk862 0 1 Tc1 Clone pRPCH11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK862_R TATNCTNNTTGACAGGANNTGGTANTTNGCCAGTNCATTCAGGNCCNGNGTGTCCATCCA GCATCATGGNGTTGNCNGCCANNTTTGAGTACGAGC Allele pk863 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK863_R Allele pk863 0 1 Tc1 Clone pRPCH4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK863_R TATGTNNACNGGTANNTNNTCAAGTTNAAAATCGACAGTNGACGCCATAGNNAGAGGCCA NNGGTTCCNNNACGAGATCAACGNTTCNCGTACTCNA Allele pk864 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK864_R Allele pk864 0 1 Tc1 Clone pRPCH5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK864_R TANNTGNGGTGGAAGANGCANNCCNCTTAAGTGACATTCGNTGGCCAGATC Allele pk865 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK865_R Allele pk865 0 1 Tc1 Clone pRPCH6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK865_R TATGNGCACGCNCAAGCTTTCAAGATCCAAANNNAATTGGGATC Allele pk866 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK866_R Allele pk866 0 1 Tc1 Clone pRPCH7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK866_R TATGTNCACGNNCAAGCTNGAACATCCAAATTNGANTTCCGGATC Allele pk867 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK867_R Allele pk867 0 1 Tc1 Clone pRPCH9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK867_R TATGTTNATGNTACAANGTTGGATNTGTTNAAGGTGGTGTTTACNATGACAAAACGTACT GCTGTNCTGCTATGATGATC Allele pk868 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK868_R Allele pk868 0 1 Tc1 Clone pRPD1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK868_R ANGCCATCANGTNTTTTAANGGGAANATTACGATTGATTCGAACCTCTTGGTTTTGGAGT TTGNAAATCTGGTACATCAATNGAAATCGATCCAAGGNGAGGNCAGCNATTCTCGTACGG CATNCCCCTTTNCNAGANTCGCTGTCTTCTNAGCTGAANATTAATNTTNGGTGNNAGTAG TGCNCCGCNNCNCGTNNTGNCTGGGNNACTTTTGNGGATTNAGA Allele pk869 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK869_R Allele pk869 0 1 Tc1 Clone pRPD10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK869_R TNAGCCATCANGTCGTTTANTGTNANTCNTCCCAATTTANATACCACGATGAAGGATTTC NAGAGTNTCCTTGAGANTGTTTATCATACACATGNTCC Allele pk870 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK870_R Allele pk870 0 1 Tc1 Clone pRPD11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK870_R ATCANGTCGANTNNGNGNTCACCTACGGTCCAGCCCATTGNANTGATTGCTTCAATGAGT TGGTACTATAGATGCACTCGGTAAAAGAAAAAAGACGTGTACATTTNATCCAAGGAGAGG ACAGCGATTCTNGTACGAACGGTTACGATTCGAGANGGGAGAGC Allele pk871 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK871_R Allele pk871 0 1 Tc1 Clone pRPD13 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK871_R CANGTNNGTTNGTNNCCAAGGGAGGACANGCAATTTTGCGTAACGANCGGTTCANTATTT CGAGTAAGNNNNAGCAAGGNGACAACAGCGNTTCTCGTACGATACGNTTACGAGTTCGCN AAGNGAGAGGACACACGATTCTTGTACGGACNTTNCGGTTCNAGAAGGGNNAGANGNAGN GTGNCATGTTTGTCTNCTGCATNNNAGTTTNGTGTANATCATAC Allele pk872 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK872_R Allele pk872 0 1 Tc1 Clone pRPD14 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK872_R CCATCANGTNNGTTCGTNACCAAGGAGAGGACAGNNAATTTTGGTNACGANCGGTTANNA TTCGAGAAGNNAGAGCAAGCAGAGGNCAGCGATTCTCGTACGNACGGTTACGATTCGAGA AGGGNGAGTACAGCNATTCTCGTACGTACNNTTACGNTTCGAGANGGGAGAGANNNAGAG TNCAGCNATTCTTNTNCGTTCNTGNANATTNTGCTAAC Allele pk873 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK873_R Allele pk873 0 1 Tc1 Clone pRPD15 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK873_R CCATCANGTNNGTGCTNGCACAANTTCAGAACANNACCANTGTTNNCCGGGCCTTCGCAA ATNACGCATTGTTGACATCACCAGAGTTTTATCGATCC Allele pk874 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK874_R Allele pk874 0 1 Tc1 Clone pRPD16 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK874_R NCATCANNTNANTNTNAGGTGTGCGCANNNCCAAGGNAGNAGGNACAGCAATTGCTGGTN ACGAACGGTTNANNATTCGAGAAGGGAGAGCGNTTCTCGTACGAACGGTTACGATTCGAG AAGNGAGAGAAGGAGAGGACAGCGATTCTCGTACGAACGGTTACGATTCGAGAAGGNAGA GGACAGCGATTCTCGTACGAACGNTTANANTTCGNGGAGANG Allele pk875 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK875_R Allele pk875 0 1 Tc1 Clone pRPD17 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK875_R NCATCANGTNNAGACNATTGCGCNTNTTNGAACAACTGGAATTTTTNNAACTNAACAAGT GACTNGATCCAAGNNGAGNGCAGCGNTTCTNGTACGAACGGTTAGNCTTCGNGANGNNCG Allele pk876 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK876_R Allele pk876 0 1 Tc1 Clone pRPD18 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK876_R NCCATCANGTNGTNNCCAAGGNGGAGGTACAGACAATTNTGCGTCACGANCGGTTANAAT TCGAGNAAGGGAGAGTACAGCAATTCTTTTTGGCCAACACTGTATTGACTGGGCAACCTG ACAGANCTATGTTATGAAAATGATCCAAGGNGAGGACAGCGATTCTCGTACGANCGGTTA CGATTCGAGAAGGGNGAGAGGACAGCGATTCTNGTACGGNAC Allele pk877 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK877_R Allele pk877 0 1 Tc1 Clone pRPD19 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK877_R NCATCANGTANCNCCCAAGGNGAGGGACAGANAATTTTGCGTNACGCANCGGTTGANAAT TNCGAGCAAGGGAGAGA Allele pk878 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK878_R Allele pk878 0 1 Tc1 Clone pRPD2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK878_R AANNGNCANCACTGNCAGCACTGTATATGTGATATGTGATGATTCAGATTCACTAACCAT ATGAACCTGTGGGATTTTCCTAGTAGAAAATATTAACTCACCTCAAAAGTATGTACTTTN CCTTGATCC Allele pk879 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK879_R Allele pk879 0 1 Tc1 Clone pRPD20 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK879_R GANCATCANGTCANTGCCNCTTCNAGCAAGCCTNACCATTTGNANCANCTATGTGGTCAC AAATNTNAANTNATGATNNTTTGGACCTNCCCGAGGGCACGNTTNNTGAAANGGCATTGA CCGTNGNTGATCC Allele pk880 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK880_R Allele pk880 0 1 Tc1 Clone pRPD21 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK880_R NCATCANGTNACGTGCTNCACANNTNNAGACCANNCCNATTCCANTCACCGGCCTTGGNN AATACGCAATGTTNTGCATCACNAGGGTTTTNNCGANCC Allele pk881 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK881_R Allele pk881 0 1 Tc1 Clone pRPD22 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK881_R GCCATCANGTCTNCAACCCAGNNGAGCGTGGTCAATTNAGCCAGTTCATNCAAGGTTTCG GCCTTCATAAACACATTAGGCTGATNACCCAAGGNGAGGACAGCNATTCTNGTACGGCAT GCCTGGNTTATCACNTNNTCCTGTANNTATNGCTGATGCATCGNNTGCGNTNNCGGNACA AGCTNNTTNNCAGAANTTGGTNGNNGTCATNTGCGGTNTTNA Allele pk882 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK882_R Allele pk882 0 1 Tc1 Clone pRPD24 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK882_R CCATCANGTNNANGTTAAANNNNNAATTCACAGGTTNCCAAGGTAGCAGGTACAGCGATT CTGGTGACGAACGGTTANGATTCGAGAAGGGAAGGAGAGGACAGCGATTCTCGTACGAAC GNTTACGATTCGAGAAGGGAGACAAGTNGAGGNCAGCGATTCTCGTACGAACGGTTACGA TTCGAGTNGAGNACAGCNATTCTCNTACGNACGNTTACGAAC Allele pk883 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK883_R Allele pk883 0 1 Tc1 Clone pRPD25 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK883_R TCATCATGTCACTGAGCTACTANCAAGAACTNNNNTTAANTGACATTATTGGCCANATCC AAGGAGAGNACGNTNTCTGTCGAAGGTAAGGAACGNACGAGAGAAGGGAGAGC Allele pk884 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK884_R Allele pk884 0 1 Tc1 Clone pRPD26 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK884_R GCCATCANGTNANTGATTNCCAAGGTGAGGNCAGGCAATTTTGCGTACGCACGGTTANAN TTCGAGTAAGTNAGAGAGNACAGCNATTCTCGTACGNNCGGTTACGATTCGAGAAGGGCG AGGACAGCGATTCTCGTACGAACGGTTACGNTTCGAGAAGTCCGAGNG Allele pk885 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK885_R Allele pk885 0 1 Tc1 Clone pRPD27 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK885_R TCATCANGTCACGTTCCNTAACCGTNTTCCAATCAATCCCAAGGTAGAGGTACAGCGATT NCTGGTACGANCGGTTAGCATTCGAGAAGGGAGAGGACAGCGATTCTCGTACGAACGGTT ACGATTCGAGAAGG Allele pk886 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK886_R Allele pk886 0 1 Tc1 Clone pRPD28 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK886_R GNCATCANGTCACNTTTCAAANANNTTTTCTCAGCTGTTTTCCNAGCGGAGNACANAGAT TNTNGTNCGNCCGNNNACTCTNCGNGACANCAGANNTCANNGGTNCTNCCACGAACGGTT NNGCTTNGCNNNGNCGGTNTTCANNGTTTNTGTNAACGATCGNTTNNNNTTCNGNCATGT GTGANATCAGTTATCCTCGTACNNTATCGNNAGATTNNNNA Allele pk887 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK887_R Allele pk887 0 1 Tc1 Clone pRPD29 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK887_R CATCANGTCGNTACCAAGTGCAGGNACAGNATTTTGCTNACGAAACGGTTCANAATTCGA GAAGGGAGAGGACAGCGATTCTCGTACGAACGGTTAGATTCGAGANGGGAGAGAGGACAG CNATTCTCGTACGAACGGTTACGATTCGAGAAGNGAGA Allele pk888 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK888_R Allele pk888 0 1 Tc1 Clone pRPD3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK888_R NTCCAGTNNTCAACAGGTTACCAAGGTGNAGGTACAGTNAATTTTNGCTCACGAANCGGT TANNATTNCGAGNAAGGGAGAAAGGAGAGGACAGCGATTCTCGTACGAACGGTTACGATT CGAGAAGGGAGA Allele pk889 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK889_R Allele pk889 0 1 Tc1 Clone pRPD30 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK889_R GCCATCANGTNGTNATGGNGATACCAAGGAGAGGACAGCAATTTTGGTACGANCGGTTAN AATTCGAGAAGG Allele pk890 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK890_R Allele pk890 0 1 Tc1 Clone pRPD31 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK890_R CANGTCNTAANGNCNNCCANCTGNGAACAGTGATNNTGCTGACGTNCTTTAGGTNACGAG GANGAATAGAGAGAATC Allele pk891 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK891_R Allele pk891 0 1 Tc1 Clone pRPD32 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK891_R TNCGNCATCANGTNGTCACTAGTTCCCAAGGGGAGACAGCGATTNCTNGTAACGNNCGTT TCAGAATTCGAGAAGGGAG Allele pk892 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK892_R Allele pk892 0 1 Tc1 Clone pRPD33 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK892_R TCACCANGTNTGANNCCANGGTGTNNNTGGGCNCCGCAATGNNNCAGGTAAAATGNCCGT CCAATCCNAGGAGAGGACAGCNNTTCTGGTACGAACGGTTANNNTTCGAGAAGTGAGAGG NCAGCGATTCTCNTACGNACGNTTACGATTCGAGANGCG Allele pk893 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK893_R Allele pk893 0 1 Tc1 Clone pRPD34 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK893_R NTCANCCNTTTGGTCATCACTGTNACCNCCTTTTTTATTACAGCCACCAGCAAGTCGTCC AAATCTAGCTGACATCATATCGGNTCTGGTTCAAAGATCAAGGAGAGGNCAGCGATTCTN GTACGAACGGTTACGATTCGAGAAGGGAGAGGACC Allele pk894 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK894_R Allele pk894 0 1 Tc1 Clone pRPD35 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK894_R CANGTCTGTTCGTNACCAAGTGCAGGTACAGCAATTTTNCTCACGAACGGTTANAATTCG AGAAGGGAGAGCAAGGAGAGGACAGCGATTCTCGTACGAACGGTTACGATTCGAGAAGNG AGGAGAGGACAGCNATTCTCGTACGAACGGTTACGATTCGAGAAGGNAGAGCTGTCTNTC GAAGGTAAGNAACGNACGNGAGAANNGANAGCAAGGNGAC Allele pk895 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK895_R Allele pk895 0 1 Tc1 Clone pRPD36 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK895_R TNTNTTNGGNCAGCACTGTGGATCAGATTGANACTTTCCTGTTCACTGAACACAAATTTT NAATTATTCCTGCAGTTTTTTTNGCCCTTNGAATTTTNACCTACCTACATACCTACCTNA CCTAGTNTTNNTCTAGTTGCGGAGTCATATNNNNGACAGAAAAGACCGGTACCAGGTCCT GANGCGATCCAAGGAGAGGACAGCGANTCTGGTACGNNCGGTNAC Allele pk896 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK896_R Allele pk896 0 1 Tc1 Clone pRPD4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK896_R GTCAGCANGTNTCATCNAAACAANCAAATTGCACACACACACACANGACGTGNNNGCATN GNCCCTGCGCAACAGCGCGAAGNGCGTGCACAGCAGAGTCTCCCNACTACCTGTTTNTCA TTCAGAGTNGTNGTGNATATTNGNNGNGATC Allele pk897 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK897_R Allele pk897 0 1 Tc1 Clone pRPD5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK897_R CATCANGTCANTTCCATGAACCNGTTNCAANTGTTCCCAAGGAGNAGGACAGCNATTTTG GTNACGANCAGTTACGATTCGAGANGGGAG Allele pk898 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK898_R Allele pk898 0 1 Tc1 Clone pRPD6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK898_R NTNNATNNTGNCATCANGTCATGTTNGNGNNCCAAATCATTCAGANCCTCATTNAAGGAG GTGTTTACACATGACAAANCGTACTGCTGTACTGCTATGATGATCCAAGGNGAGGACAGC GATNCTNGTNCGNNCGNNTACTNTTCGNGNNGNGTGNGCATTGNGNTNNNCNNNNTCTNN NGANNGTGGGNCCACNTTNCGATTNNNNNGNTGNTCNGGNNNTNNTNNACNTNT Allele pk899 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK899_R Allele pk899 0 1 Tc1 Clone pRPD8 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK899_R GCCATCANGTGGNTTAGGTNGAGAAGAATACCTTTNAGTGACATTGTTGGCCAGATCC Allele pk900 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK900_R Allele pk900 0 1 Tc1 Clone pRPD9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK900_R GCCATCANGTCNTTTACNGTCNNACNTCCCAATTTTNATNACCACGATGAAGGTTNTCAA GAGTTTCCTTGAGANTGTTTNTCATACACATGNTCCAAGGAGAGTGCAGCGATTCTNGTA CGAACGGNNACGATTCNTGANGTAGNGAGTGNCANNNATCNTCNTNCGANCNGTNACNGT TNTCGNANCACNAGTNCNCACANCTTATGNNACGNCNTGNNATAAC Allele pk901 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK901_R Allele pk901 0 1 Tc1 Clone pRPEA10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK901_R TATTGTACTGGGCCAACCTGNACAGCAACNATGTTAATGAAAAATGATC Allele pk902 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK902_R Allele pk902 0 1 Tc1 Clone pRPEA11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK902_R TATCTATTNTNCAAAAGTTTNTTGCGAACCCAGNTTGTGATC Allele pk903 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK903_R Allele pk903 0 1 Tc1 Clone pRPEB5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK903_R TAGNATTTTCCAAAATGAAGTATACTATGAAATCCNAAATTATANTTTTTNNGATC Allele pk904 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK904_R Allele pk904 0 1 Tc1 Clone pRPEB6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK904_R TATGACGATTGCNNNNTCTNGAAACACCTGGTCATCTTCTNNANCTNANCAAGTACTAGA TC Allele pk905 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK905_R Allele pk905 0 1 Tc1 Clone pRPEC12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK905_R TATGTTCATTATTCCAANTNTTNAGCCCNNNTTCAAGGAGGTGTTTACNATTACAAAACG TACTGCTGTACTGCNATGATGATC Allele pk906 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK906_R Allele pk906 0 1 Tc1 Clone pRPED3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK906_R TATGACCACCGAGGCAGCAATAGTTATNAGAGCCGCACACGNGGTGCCAGACTGCCCCAT TACAGTTCGATC Allele pk907 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK907_R Allele pk907 0 1 Tc1 Clone pRPIA3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK907_R TAAAGCATTTCTCATCGGTGCTGGACTTTGAAAGCCAAATACTGTTTTCTGAGTGGGTGT Allele pk908 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK908_R Allele pk908 0 1 Tc1 Clone pRPIA6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK908_R TATATGTGCAGGTACATGTCATATCAATAAAATGCTACGACGGATC Allele pk909 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK909_R Allele pk909 0 1 Tc1 Clone pRPIA9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK909_R TATTTGTTCCCAAAAAAATACGACAGAGTGCATCAAAAAGCTACTAATCATCTGGATC Allele pk910 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK910_R Allele pk910 0 1 Tc1 Clone pRPIB3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK910_R TATGCTATNAANGCTTNAATTACAGGATC Allele pk911 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK911_R Allele pk911 0 1 Tc1 Clone pRPIB7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK911_R TATGTACCANCTGGAAGCATNAATAGTTNTNAAGCGCGCACACGTGGTGCCAGACTGCCN CATTACAGTTCGATC Allele pk912 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK912_R Allele pk912 0 1 Tc1 Clone pRPIC11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK912_R TAATGGTCAAGGGTNACTGGNGTTAGGTGACAACGNCATGCATTTTTGTTAGTTTCATTA ACGATC Allele pk913 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK913_R Allele pk913 0 1 Tc1 Clone pRPIC3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK913_R TAGCTNACGTCGCAGAAGCACTNCCGTTTAGTGACATTNTTNGCCAGATC Allele pk914 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK914_R Allele pk914 0 1 Tc1 Clone pRPIC4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK914_R TATNNNANTAGGNTGACTTATCAGTGTACGCTGGGNCCGAAGACCACGGGGTACGACCAA CTGTCACCGAGAATGTTGTGTGGTTGAGAGGGATC Allele pk915 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK915_R Allele pk915 0 1 Tc1 Clone pRPID1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK915_R TATGCGTGATCTATTCAAGTCATTTTTGGTCAGATC Allele pk916 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK916_R Allele pk916 0 1 Tc1 Clone pRPID10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK916_R TAGNNNACGGTCGANGAAGNANTCCGTTTAGTGACATTGTTGGCCAGATC Allele pk917 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK917_R Allele pk917 0 1 Tc1 Clone pRPIF1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK917_R TATGTNATACCAAGGTAGAGGTACAGCGATTGTTNTNACGANACGGTTNAGNTTA Allele pk918 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK918_R Allele pk918 0 1 Tc1 Clone pRPIF2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK918_R TATTNTNNNGGGCAACCNAACAGAACTATGNTATNCAAAATGATC Allele pk919 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK919_R Allele pk919 0 1 Tc1 Clone pRPIG6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK919_R TAGTTTNCAAATTTGNTNCCAAGGAGAGGACAGCGATTCTCGTACGAACGGTTAGGATTC GAGAAGGGAGAGGAGAGGACAGCGATTCTCGTACGGCATGCCTGCAGGTCGACTCTAGAG GATCCCCGGGTACCAGCTCGAATTCTTTTTGGCCANCACTGTATGACGATTGAACTTCTT GAACAACTGGCATCTCTTAACTTAACAAGTACTAGATC Allele pk920 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK920_R Allele pk920 0 1 Tc1 Clone pRPIH10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK920_R TATATGAAGCAGAAGCTTTAAGTTNAAAATTCAATTGAGATC Allele pk921 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK921_R Allele pk921 0 1 Tc1 Clone pRPJA12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK921_R TANATCGGTTGTGGGAGAAGAACGTCGNTGTNTCAGATGGAGGAGTNCTNNAGTNTGAGA TC Allele pk922 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK922_R Allele pk922 0 1 Tc1 Clone pRPJA5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK922_R TATAACCGTTTTATATTAGATC Allele pk923 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK923_R Allele pk923 0 1 Tc1 Clone pRPJB9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK923_R TATGTATCAATCAAGTGTTATTGATGGATC Allele pk924 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK924_R Allele pk924 0 1 Tc1 Clone pRPJC12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK924_R TACGATGAAACACATAAGGTTTTGATAC Allele pk925 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK925_R Allele pk925 0 1 Tc1 Clone pRPJC9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK925_R TATAACCGTTTTNATATTCAGATC Allele pk926 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK926_R Allele pk926 0 1 Tc1 Clone pRPJE11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK926_R TATGTGTATCTNTTAAGCATTTTTNGTAGATC Allele pk927 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK927_R Allele pk927 0 1 Tc1 Clone pRPJF10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK927_R TATCTACAAATCATTCANTTCACAGGATC Allele pk928 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK928_R Allele pk928 0 1 Tc1 Clone pRPJG10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK928_R TATATGAAGGAGTANNGTANCAGGCAACANCACNAGAGATC Allele pk929 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK929_R Allele pk929 0 1 Tc1 Clone pRPJG11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK929_R CTTNNGCCAGCANGTATATCAAGCAGAAGCTTTGAAGNTGCAAAATTAATTGAGATC Allele pk930 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK930_R Allele pk930 0 1 Tc1 Clone pRPJG12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK930_R TATAACCGTTTTCATATTCAGATAC Allele pk931 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK931_R Allele pk931 0 1 Tc1 Clone pRPJG7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK931_R TAGTTCAATGTAGTACCCCAACTTTCGNNATGCGAGGACGNTATGNCATCTTNGGAAAGC TTAAGGTTANCCTAGATC Allele pk932 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK932_R Allele pk932 0 1 Tc1 Clone pRPSA10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK932_R TAGAAGTTTTTTTTAAAGACTGATGCACCAGGAAAGTNTTTTCTGCATATGACTAGCCTT GTGCACAGGAACTCATAGCAGCTGTGGCTNCCTGAAGGCATCAAGGCAGCCATGACTCCA GCATGGCTGCGGCTGGAACTCAGACTCAAGGTTCTACCT Allele pk933 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK933_R Allele pk933 0 1 Tc1 Clone pRPSA5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK933_R TATGTTTTTNTTTCNAATCACATATTGCAGACAATAGA Allele pk934 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK934_R Allele pk934 0 1 Tc1 Clone pRPSD11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK934_R TATTTGTTTTATNACNTTTTGTTNACTATAATTCGTGACCAATTTTGGTATTTCAGGCTA ACTGTTTAGAACAACAATTATCATAAAGATTCATAGAAAATATCTGGTGAATGCAAAAGT GGAATTCGAGCTCGGTACCCGGGGATCC Allele pk935 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK935_R Allele pk935 0 1 Tc1 Clone pRPSD12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK935_R TAATAGTGAAGGATACTGGGTTAGGTGACNACGGCAGTCATTTTTGTTAGTTTCATTAAC GATCAAACTAGACTCGTTTGGCAAATTGTCAAAAAAATTAATAATTTCCAAAAAAAGTAA TTTGTGGATGTGTGAATTAACCAATT Allele pk936 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK936_R Allele pk936 0 1 Tc1 Clone pRPSD6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK936_R TATGTNCGCGACTATACNTATTGTGCNGAGGTTTCTGAAAATTATANAATTTTTTAAAAA TAAAAAATTGGAAACAAATCTACCTCATAAACCAACATCCGCCGGTGTCCAGTCTCTGAC ATTGAGTGGCTCGTCGAGCCAAGCAAG Allele pk937 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK937_R Allele pk937 0 1 Tc1 Clone pRPSE1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK937_R TATATGCCTCAAAATTGGTGTAGT Allele pk938 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK938_R Allele pk938 0 1 Tc1 Clone pRPSE10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK938_R TACGCAACTTTGCAGGTGTGCAGCGTACNGATTTAGCCCTTGCGCTGGCAGCCTTGTGGC TGGGGCGATTGTGCAATCGTATGGACTACGCCGCCGGATTTATCTTTATGCGTCGACTGG GCTCGGCGGCGCTGACGGCTACCGGACCCGTG Allele pk939 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK939_R Allele pk939 0 1 Tc1 Clone pRPSE7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK939_R TATGATGATGATTGTTACCTAAAACTAGTCCGTTCCAGACTAACCTGCCGAAAGGTGTGT AGAAGTTTACGCACCGCTATTGATAAACTCGGAACTCACTTCAACAAAATATCAATTAGA TTATGGGATAACAGCGTTTCGGTAGATTTCG Allele pk940 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK940_R Allele pk940 0 1 Tc1 Clone pRPSG1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK940_R TATATACGCAACTATACATATTGTGCAGAGGTTTCTNGAAATTCTAAGTGAGAGGGGGGC TAAGGGTAGGGTANTATAACAATACAATAGGNACTTTCACTAGGAACAGTAGTGGTTGGT TTGAAGATTCTTAGTTAAATGTAGTT Allele pk941 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK941_R Allele pk941 0 1 Tc1 Clone pRPSG12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK941_R TATATGAAAGCNTGACTTTCCATCCCCGTCTTGTTAAACACAC Allele pk942 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK942_R Allele pk942 0 1 Tc1 Clone pRPSG2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK942_R TATGTGNTCAAGCGTNGAGCTNCACGAAAGTTCAACGGATTCTAAGTGAGAGGGGGGCTA AGGGTAGGGTAATATAACAATACAATAGGAACTTTCACTAGGAACAGTAGTGGTTGGTTT GAAGATTCTTAGTCGACACTTCTGA Allele pk943 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK943_R Allele pk943 0 1 Tc1 Clone pRPSG3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK943_R TATGTTGTCCGGAAAGGAAAACATAGTTGGAAATATAAANGCGTGAAGCATTACGTCAAT ATGGAGCATAAAAGGAGAGAAATTGTACGGTCACGCGAACTAAACTCAAATGCAGAAAAG AAAACAGACGTTATCGACACTTCTG Allele pk944 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK944_R Allele pk944 0 1 Tc1 Clone pRPSG9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK944_R TATTATGAGTGCCATGATCGACGTTGATCACTTCAAGCAATACAACGNTCACTATGGC Allele pk945 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK945_R Allele pk945 0 1 Tc1 Clone pRPTA11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK945_R TATATCATTCATATGCCTGCCCACGTGCCTCCCTACCGCCTATCTGTGTGAGTTTTGGAG TGAAATGAGGACTCTGGAGCAATGCATATTAACGTTACTTTCCGGGAAGGATTACAGCAA AAACTTTGGTAGTTTTGTGAATTGCA Allele pk946 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK946_R Allele pk946 0 1 Tc1 Clone pRPTA9 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK946_R TAGGTGTGCAGGAGCAGTCAACAGCTGTGGGA Allele pk947 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK947_R Allele pk947 0 1 Tc1 Clone pRPTB12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK947_R TAGATCAACTACATCAATATCAACTCACGGCAAATGACNCAAAAGGGAAATTATTCATCA ATAGCGACATGCCTGGNACTATTGAATCTAAAGGGATTCTTTTTGGTGTTGGGAAGGCAG AGTTGATTTTTAAACATAACTCTGACAATTATGCTTTTTCATCACCTTTAATTTCTAAAA ACACAGGTAATGGTATAATTNATGCAGAGAGTGGCGAGACGCATCTCACGGGAGATAATA CCGATTATAGTGGTTTGTTGAATA Allele pk948 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK948_R Allele pk948 0 1 Tc1 Clone pRPTB5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK948_R TATGTTCGATTTAATTTTAAAAAAACAACGTTTTTCATAAATGCCGAAAAACAGCGAAAA ATGCCTCACATTTTTCGGCATTCGCCAATCTTTCGAACAATTTTNGGCAAACGGCATTGG CTGTTCGCCGTTTGCCGCACAGCCCTGGTTCCAAGATGAATTGCCAAAAATGGACCTGTA AGATGTCAGTCGCTCCAACTTTTATCCAGAGTGGAATTGATAAAAGTTGATCANCAGCAA AAAATGTAGACAN Allele pk949 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK949_R Allele pk949 0 1 Tc1 Clone pRPTC5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK949_R TATCCACTAGGGTGCGACCTGGCAGGCATGCTACTCCCTTCTCTCGTCCGTTTCTNACCT TCGATAGATAGCGTCCTCTCCTTGCTCTCCCTTCTAGAATCGTAACCGTTCGTACGAGAA TCGCTGTCCTCTCCTTGCTNTCCCTNCTCGAATNGTAACCGTTCGTACGAGAATC Allele pk950 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK950_R Allele pk950 0 1 Tc1 Clone pRPTD11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK950_R TAGNNACCGAGCANGCAGGTTTTTTCAATGTCGATACAACTTAAGTATCACAGAGAAATT TTAGGCC Allele pk951 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK951_R Allele pk951 0 1 Tc1 Clone pRPTD12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK951_R TATCCCCTAGAGTCGACCTGCAGGCATGCCCTCCCTTCTCGAATCGTAACCGTNCGTACG AGAATCGCTGTCCTCTACTTGCATTGAGCGCGTG Allele pk952 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK952_R Allele pk952 0 1 Tc1 Clone pRPTD4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK952_R TAGTTCTCAATTTTCAGCACCATGGCGATCTGGAAGCAGCTAAAACGCTGATCCTGTCTC ACCTGCGGTTTGTTGTTCATG Allele pk953 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK953_R Allele pk953 0 1 Tc1 Clone pRPTD5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK953_R TATGTGAAAACTTGACGAATGGGGTCTCAGGTAACTNTTAACNAAAAATCAGCAGAAGCT TGGACTACATGAGAACCTGTAAGTCTTGAGTGGGTTAATACTCTCTCCTCCCGCAGCTCG ACGTTGTAGTAGCTGAAGAG Allele pk954 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK954_R Allele pk954 0 1 Tc1 Clone pRPTG10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK954_R TATGTCATGTGCAGTTATTCACAAGCTGATCGACTCGATGCCACGTCGTTGTCAAGCTTT TATTGATGCAAACGGATACGCGACAAAGTATTAAGCATAATTATGTTGTTTTTAAATCCA ATTGCTCATATTCCGGTACTTTAATT Allele pk955 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK955_R Allele pk955 0 1 Tc1 Clone pRPTG12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK955_R TATATGTCGCATAAATGAACACCTGTTTTTGCAGGCCACTCGTTTTTTTGTTGATTTTTC TGGTCCACAAATGAATATTATTG Allele pk956 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK956_R Allele pk956 0 1 Tc1 Clone pRPTG6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK956_R TAGATCTACAAAAAATGCAAGAGGAAAAATGTGAACGCAGACATTTCATCTGATTTCGCA TGTACCAATTCGAGAACGACTTGCACGAAGAGGAACAAGCGGTAAGTGACGTGCCCTCAC ATGGTCCGCTGGCGCTGGTGACGGAT Allele pk957 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK957_R Allele pk957 0 1 Tc1 Clone pRPUA1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK957_R TATATGTGTTTGTNCGTGTGGAGTACACGTGGTGCGGCGGGGGTGATTGTCAATGGCGCG CGAANACGTNNCNNGAAGGGAGAGCAAGNNGAGGACAGCGATTCTCGTACGAACGGTTAC GATTCGAGAAGGGAGAG Allele pk958 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK958_R Allele pk958 0 1 Tc1 Clone pRPUA11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK958_R TACGTTGGTTCGCCTTCAGCATGTNCATCCAGCGATACTTTTGAGAAACTGTATATTGAG CAA Allele pk959 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK959_R Allele pk959 0 1 Tc1 Clone pRPUB1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK959_R TAAATACAAGGAGAGAGCAGCGATCTGCACGTACGAACGGTTACGATTNCGAGAAGGGAC AGCGATTCTCGTACGAACGGTTACGGTTGAGAAGGGAGAG Allele pk960 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK960_R Allele pk960 0 1 Tc1 Clone pRPUB11 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK960_R TAGGTTCTTGCAAAGTATCACTCCAAAACTGGAATATTCTTTGTTGATGCTTTNGCTTGA ATTTCATAGGGTACATAATTTTAGTATTCTTTGAAGTTCAAACATTTCCCAAAATAGTCT CTGCCCATATCTTGGTAACTGCCAATATTTTNNTGNTTCACAAGTTTTTTTTTCACTTTT CGTGAACTTAAGTTTGTATTCGTGTTTTTACTCAAGCCGGTAAAATATTAAGAAAAATCA GCCACAAATATATATACAACACATTTTCCAATTATTCTACTGTNTC Allele pk961 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK961_R Allele pk961 0 1 Tc1 Clone pRPUB7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK961_R TATATGTGTCGAGACAAGGAGATGACAGCGATTCTCGTACTCAACGGTTACGATTCGAGA AGGGAGGG Allele pk962 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK962_R Allele pk962 0 1 Tc1 Clone pRPUC5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK962_R TATGTTCTTTCACCAAATAGANCAAGTCGACAGCNATTACTTGTACGANCGGTTACGATT CGAGAAGGGAGAGCATG Allele pk963 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK963_R Allele pk963 0 1 Tc1 Clone pRPUC7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK963_R TATGTNATGATATCAACTTTTTTTCCTCACGTTGCCGANGTTTTNNCCGGGTAAACGGCT TGGAGGCAACACTTGTATAATCAGAGCAGCTTTGGAGCTCACAGCAAAATTGGTAATTCA CTTACCTAGGCTGGCAATCAGGGTGGGCACCGGCGCTTTTGGCAAATTTCGAAAAACAAA CTTATCTGTCAGTGTTTATGTAGCTTTTTGGCAA Allele pk964 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK964_R Allele pk964 0 1 Tc1 Clone pRPUD6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK964_R TACCTCCCAGTGGAAAATTTACGATTGACCTGATGAGCCTGCCAACTCCTCAGAAATTAA GTTCCAAGCGCCGTCGAGCAATTCTTGTGTTCAAGAGGAAGAAGCAAGTATAGAACTTAT TTAAAGCTTAGCTAGAGAATAAATATTTATTT Allele pk965 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK965_R Allele pk965 0 1 Tc1 Clone pRPUE5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK965_R TTTGGTCATCANGTATACCATAACTGGGTGTAGCTGAAACAACTCGATTTTACCACAAAT GGGTTTAAAAAAACCAACCCCATTTGACACTTCCTCGGCTTTC Allele pk966 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK966_R Allele pk966 0 1 Tc1 Clone pRPUE6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK966_R TACTTACACCGTTCTGACGTTGACGTTTTTTTTTCAGTTTTTATTTNCTTTTCACATACC ATTACTGATAACTTATCATAAAAACGGAACCAACANTAGGNAAAAAGTTTCTGTATATTT TTTGCACTNCGTTCACACTCACTGTAGATAG Allele pk967 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK967_R Allele pk967 0 1 Tc1 Clone pRPUF2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK967_R TATACCACTTATTCTAAATTTACAGTAATTCTGGTAATCGCAGTACATAATCAATTATCT TCAAACTTTCCCTCACTACAAATTGCTGATGC Allele pk968 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK968_R Allele pk968 0 1 Tc1 Clone pRPUF3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK968_R TATCTATCANTTTTTTACTTTTCGAGAAAAAATTTCTCGTTTTTCCCTTTTTTTGGATTG AGAAGAAAAAATTGTTTGCCTTCGCCTTTATTCAGTAAAAAGTTATTGACGTGAGCTTTA GGAAAAAGGATTGAAACAGTAGATTTTTTTCCA Allele pk969 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK969_R Allele pk969 0 1 Tc1 Clone pRPUF4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK969_R TATGTCGACCTCAACTTCATATTTAACAAATCAAAAAGTAATTC Allele pk970 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK970_R Allele pk970 0 1 Tc1 Clone pRPUG3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK970_R TACAGAGCGATTACGTTTGCAGCAGAAGGGCCTTTGGCACCGTTAGTGATTTCGAACTCT ACGCGCTGACCTTCAGCAAGAGTTTTAAAACCATTAGTCTGGATTGCAGAGAAGTGTACG AACACGTCTTTGCTGCCGTCTTCCGGAGTAATGAAACCGAATCCTTTGGACTCATTAAAC CACTTAACGTTACCTTTAATCTTAGACATCAAAATTACCTTTACATGAAAAATAGACACA AATGCTGTGTCGGTTACCAGTACACCAATTGTGG Allele pk971 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK971_R Allele pk971 0 1 Tc1 Clone pRPUH4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK971_R TAAATCCTAAATGAACCGGTGCATCGATAGTTTTCTAGAAATTTCAATGAACATNTTTAA ATAACAAACATTATAAGTNAATGGCA Allele pk972 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK972_R Allele pk972 0 1 Tc1 Clone pRPUH5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK972_R TAACTGGGTTTGCGACGCACTGTGTGAGTTTCCCAGTGACCCGGTAGATGTCGGGA Allele pk973 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK973_R Allele pk973 0 1 Tc1 Clone pRPVA12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK973_R TATGTCGTTAAGTNTGATTTTTTCTAACCAATAAAATGTGTATATTCAGTTGTCTTGCTC GCTGACCAAAAAAAAGTTACAGTGCCCTAAAGTGGTCGCAATAATTAAGGACCACCCTGT ACAAACTGTGACGTCACACAAATTTTTAACAAAAATGGCGGTTTCTAAAGATCAAATTCG NAAATTCTAATTCTAACTATCCGTAACTTTGGTTACAACAACAAACTCATTTTTCAAATT ANCTATGCCTAAATTGATTTTAAATTATA Allele pk974 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK974_R Allele pk974 0 1 Tc1 Clone pRPVA5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK974_R TATGTTTTTCATTTCAAATGCACATCATTGCAGACAATAGA Allele pk975 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK975_R Allele pk975 0 1 Tc1 Clone pRPVE5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK975_R TAGTAAAGCAAAACAAGCAGATGAAGGTCACCTTCACAGGTCAGGCAGGCCGGCGAGTAG GTTACCGCGAAGGTAACGAGGGAAACGTAGACAGCCAGTTAGGCAGGCGGGCATAAGTTG CATTGAACGTTGGTAGGCAAGGCTAGGTAGCCATTAAAGCATCTCAAGTCTAATTAGTTT TAGAGGTAGGCGTAGGTTACCTTGAAGACGAATAAATCGCATTGGATGGTTGCATTGGAT GTAGGTAGGCAAGCATAGGCGCGTAGGTTAGGCGCGTA Allele pk976 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK976_R Allele pk976 0 1 Tc1 Clone pRPVE7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK976_R TAGTTTCAAATTTGATCGGCTCTCAATGTTGACTCTAAGTATATATTATATTACCTGGCT AACTTTGACGTCATCTTTTTGTGAATNTNTCTTCTGGGACGACTCTACACTCTTTCCATC AGCCGTATGTNCCACTTTCTTTTCAGAACTCTTTGTTGTCCGTNTGACACTNGTNGTAGT TTGAACAGTTGTNGTCGCCTGCTTTTCTGACGTCATCACAATCTTTGTNGGTTTCTNCTC GTCTGAAACTCAAGATTNGAAAAAAAATTCGAGGA Allele pk977 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK977_R Allele pk977 0 1 Tc1 Clone pRPVF1 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK977_R TAGTTCTCANTTTTGCAGCAC Allele pk978 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK978_R Allele pk978 0 1 Tc1 Clone pRPVG10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK978_R TATCAAACAAAATGGACCAAATCATGAGCATTGAAAAGAACCCATTTAACCGATTTCATT GATTGTGGAGTTTTGAATAGAACACAATACAGGCCAAGTATTTGGAGTGGGCAGGCTACA GCTCCCATAGAATGTAGAGTATAAAAAAAGAAATCCGGGCTTTC Allele pk979 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK979_R Allele pk979 0 1 Tc1 Clone pRPVH4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK979_R TACATTCCAAAGTGCACAGTGTCCTGGTGCATTGGTATGAAGAACGAATTTGACAACACG CTTCAAGACAGGGGGNNACAGAATATCCTGAAAAAATAATTTATAATATAATTGTTTCAT CGTTTTTTTTTCTAGAATAGTCTACCCAACTTCAAAGTTGTCCCCTTTCTATTAATTTAA AAGTTTTCCGTCACACTTTCCCAGAACTTTCAATATAAATTTGAAAACTAAATCATAGTA TCCAATTTCATTCTCTTTGCGTTCGTTTC Allele pk980 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK980_R Allele pk980 0 1 Tc1 Clone pRPVH6 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK980_R TATAGNTTTTATTCATAAGATGATTAAACGAGTTCACATGAAAATGGGATTTCGATTTTT TAACGACTTTGNNNGATTATTTTTCCCGAGGTTAGT Allele pk981 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK981_R Allele pk981 0 1 Tc1 Clone pRPWA3 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK981_R TATGAATCATACGAAAAGTTTGGTTATGTGTTTTATAATCCCATTTTTAAAATTATTTTT TGACTAAAAAGGTAAGGATGAAATTCTTCAGCTTAGAAAAATACCAAAATACCAATTATT AACCCTATATGAAAAGATGTGTATAAATTTCAGTTAATGTAAAGACCGCATATTGTCAAT GGTTACTAAATCTAACTGCACTCATTATAGTCCAACATTTCCATTATTTTTTTCTAAAAA G Allele pk982 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK982_R Allele pk982 0 1 Tc1 Clone pRPWC4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK982_R TACATATTCGGCATTTTTACGAGATTAACACACACTCAATATTTCAAGGACTTGACGATT TCTATGACAAACCGAATTATATTCTTCTGATTTGAAATTGCT Allele pk983 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK983_R Allele pk983 0 1 Tc1 Clone pRPWE10 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK983_R TATATCAAAACACCTAGTCA Allele pk984 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK984_R Allele pk984 0 1 Tc1 Clone pRPWE5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK984_R TACCACGGATTTGAATTGAGAATATGCANTTTTATTTACAGGGTCCTGGACCACCAAGTT TTGAAAAACGTAAAGTGTCAGAATCAGAGAAAAATGTTATGTTTGGTTGTTGTTGTGAGA AGCGTCGATTGGGTGAAGTTCTTGTCCAAAATGGGATTAGTACAGAACTTCCAGAAAAGA TTGTATGCCAATTGTGTTTCAATTGGATGAGATTATGCGTTCGGCGAACTCCATT Allele pk985 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK985_R Allele pk985 0 1 Tc1 Clone pRPWF2 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK985_R TATATGAACTTACTGTGTAATAGGGTTC Allele pk986 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK986_R Allele pk986 0 1 Tc1 Clone pRPWF5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK986_R TATGTATGTACCAGTAGCAAGAATGAAAAGCACTTTTGGAGAGTGTAGATGAGCTGGAGG GCAACATCATATTTAGATCGGGGATCCCGTCCCCCAATCAATATCATCACCTTCCCACAT CTCCACATACGGACAGACATCATGAGGAGATGGCAGCGATTCTCGTACGAACGTTTACGA TTCGAGAAGGGAGAGCATA Allele pk987 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK987_R Allele pk987 0 1 Tc1 Clone pRPWG4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK987_R TAGATTGAATTTGAACCAAGCACCTGATTCCTTCATCGCCAACGTTTTTTGAAGAAAATG TATTCATTGCTCGGAGTGTACAATTTATGAAATTCGTGTGATTTAGCTCATCGTCTTTCG TATTATAAG Allele pk988 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK988_R Allele pk988 0 1 Tc1 Clone pRPWG7 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK988_R TACATCTCATATACGTTACCTCCTTTCTTGCAGGAAGAAAGGTGGATATTATAGACTGTT TTACAACCTATTGAGGGACCTCTTACAAAAACAAATGTGGTGATGCTGTCGATTGTTCTT CGATATGTCGTAAAATATACATACCTGATCCTGTAACAGTAATTAGAGACCATATTACAG CC Allele pk5328 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5328_L Allele pk5328 1 0 Tc1 Clone pRPE28 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5328_L NNCATCACGTNNCNGAGAAAANANCACAGTTCCGTTCTGTGCCATCAGTTTGTCAGTCTA TGTAGTCTTTGTAGTCTGTNACGACACACCCAAAGTCAGTGAGAGTTNTGGGCGGGGNCT NTNACCTNCNTGNGGAGACCATGNNGTGNTGAGATT Allele pk5329 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK5329_L Allele pk5329 1 0 Tc1 Clone pRPFG12 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK5329_L TATACATAAAAAAATACAGTTGCTNTGTGCATAGTTTGTAGTGTATGTAGTCTTTGTAGT NTCCTGAGTGANANNNAAAGTCAGTNAGAGTTNCGNGCGGNGNATGTNACGTTCGNGGTG AGACTNATNGCGGTGAGACCTTTNGTGGTGACANNCATCACTGGTGAGACCTTCGNGCTC AGACCATNGTCCTGCGATAAACN Allele pk989 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK989_R Allele pk989 0 1 Tc1 Clone pRPSD4 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK989_R TATGATGATGATGATGATGATGATGAGTGCATAGTATTTAAACGATACGTAGAAACACAT AGTATCAGGTTGTCNCATAAGTTTTTGTACTATTTTTTTTTGAAAAAAATTTATTTCTCT CAAGCGACAAGTAGTACCATTCACACAAGTATT Allele pk990 Transposon_insertion Tc1 Author "Korswagen RC" Author "Smits MT" Author "Durbin RM" Author "Plasterk RHA" Remark "This allele is a specific Tc1 insertion, defined by flanking sequence. It needs to be confirmed before it is further studied." Strain RW7000 Sequence PK990_R Allele pk990 0 1 Tc1 Clone pRPSH5 Remark "This is a consensus sequence defining a Tc1 insertion site. See the allele object for further information." DNA PK990_R TAATATNACNNTAGAAACACTTAAATTCCAACAAAAATGAGCAAACTATAAATAATTTAT GANAACTCCGCATTCTTTAAACTACAGTACTCATTAANGGTGCACACCTTTNCGAAATTA ATTGATTAACAANAAATGTGTCGT